Coleus forskohlii (syn. Plectranthus barbatus) is a widely used medicinal plant and its main bioactive constituents are diterpenes forskolin and isoforskolin. The present study aimed to construct a cDNA library to identify expressed sequence tags related to terpene biosynthesis in C. forskohlii. We constructed a high quality normalized full-length cDNA library which reached the requirements (abundance, integrity, and library content) for isolating full-length genes. A total of 4 224 cDNA clones were sequenced and 2 394 unigenes were assembled with an average unigene size of 753 bp. A total of 2 100 (87.7 %) unigenes were functionally classified using gene ontologies, and 1 716 (71.7 %) unigenes were assigned to establish pathway associations in KEGG mapings. Notably, 64 unigenes putatively participated in the biosynthesis of secondary metabolites, in which 17 unigenes were identified that might be involved in the biosynthesis of the terpenoid backbone and monoterpenes, diterpenes, and triterpenes.

Assam tea (Camellia assamica) is perennial crop susceptible to moisture stress. We used its tender roots to construct a cDNA library for the identification, functional annotation, and analysis of transcripts. A total of 811 full-length expressed sequence tags were generated. After processing and assembly, 207 unigenes comprising 58 contigs and 149 singletons were registered. Finally, 35.75 % of the unigenes could be assigned to functional categories based on the Arabidopsis proteome. There was 43 % of a coding GC content and 1 272 coding DNA sequences found in the unigenes. Codon usage analysis shows leucine as the highest (9.92 %) and tryptophan (2.0 %) as the lowest coded amino acids. Further, a comparative study with drought-induced genes of young roots (reported earlier) reveals that 4.83 % of genes required for normal growth of roots were also induced by a drought stress. Expressions of 10 unigenes under different abiotic stresses, such as drought, cold, and salinity, were further confirmed by RT-qPCR. The sequence tags generated in this study will be valuable resources for functional genomics study of tea and other woody crop plants in future.

Pseudoroegneria libanotica is an important herbage diploid species possessing the St genome. The St genome participates in the formation of nine perennial genera in Triticeae (Poaceae). The whole chloroplast (cp) genome of P. libanotica is 135 026 bp in length. The typical quadripartite structure consists of one large single copy of 80 634 bp, one small single copy of 12 766 bp and a pair of inverted regions (20 813 bp each). The cp genome contains 76 coding genes, four ribosomal RNA and 30 transfer RNA genes. Comparative sequence analysis suggested that: 1) the 737 bp deletion in the cp of P. libanotica was specific in Triticeae species and might transfer into its nuclear genome; 2) hot-spot regions, indels in intergenic regions and protein coding sequences mainly led to the length variation in Triticeae; 3) highly divergence regions combined with negative selection in rpl2, rps12, ccsA, rps8, ndhH, petD, ndhK, psbM, rps3, rps18, and ndhA were identified as effective molecular markers and could be considered in future phylogenetic studies of Triticeae species; and 4) ycf3 gene with rich cpSSRs was suitable for phylogeny analysis or could be used for DNA barcoding at low taxonomic levels. The cpSSRs distribution in the coding regions of diploid Triticeae species was shown for the first time and provided a valuable source for developing primers to study specific simple sequence repeat loci.

Nucleoside diphosphate kinase (NDPK) operates in the homeostasis of cellular nucleoside triphosphate (NTP) pools and the cytosolic NDPK1 is the main NDPK isoform in plants, accounting for more than 70 % of total NDPK activity in plant. A full length cDNA (697 bp), designated as CsNDPK1 was cloned from Camellia sinensis (L.) O. Kuntze leaves. Sequence analysis of CsNDPK1 shows several motifs, binding and catalytic sites which are highly conserved among other NDPKs. Southern blot analysis revealed that tea genome has two copies of CsNDPK1. Transcription pattern analysis indicated that CsNDPK1 is expressed in all tissues examined, but expressed more in buds than in other organs.

Eragrostis curvula (Schrad) Nees (weeping lovegrass) represents important cultivated forage in semiarid regions, and the most useful cultivars are tetraploid and reproduce by pseudogamous diplosporous apomixis. We previously produced a series of genetically related E. curvula lines that provide a suitable system for the identification of gene(s) involved in diplosporous apomixis and ploidy, including a natural apomictic tetraploid (T), a diploid sexual line (D), and a tetraploid sexual plant (C). A collection of expressed sequence tags (ESTs) was generated from cDNA libraries obtained from panicles of the D, T, and C, and leaves of the T. The present study aimed to analyze the repetitive content of these four cDNA libraries and further identify and characterize transposable element (TE)-related ESTs. Repetitive sequences were identified through the interface RepeatMasker (RM) using the database Repbase Update and further classification of TEs was performed manually from the RM output. The different contribution of ESTs with identity to TEs among libraries was further evaluated, and such differences were validated through RT-qPCR. We found that the percentage of repetitive content in the leaf cDNA library was almost double than in inflorescence libraries, with retrotransposons contributing mostly in all libraries. The expression of TE-related ESTs was compared in cDNA samples extracted from D, T, and C leaves or inflorescences revealing that seven mRNAs containing MuDR-like DNA transposons, Gypsy-like, and Copia-like retrotransposons were differentially represented according to tissue, reproductive mode, or ploidy. The euploid series of Eragrostis curvula is a useful model to the study of epigenomic changes produced after changes in ploidy. The present work constitutes the first detailed report on repetitive sequences of Eragrostis curvula at the transcriptome level.

Cinnamate 4-hydroxylase (C4H) is the second enzyme in the phenylpropanoid pathway which participates in the synthesis of numerous phenylpropanoid compounds such as flavonoids, lignins, suberins and others. We identified a gene putatively coding for Class I C4H in apricot and plum and we analyzed the expression pattern of this gene under different apricot/plum graft combinations with different degree of compatibility. The full-length cDNA is 1 739 bp with a 1 515 bp open reading frame encoding a protein of 504 amino acids. Like other C4Hs, the predicted C4H polypeptides included conserved domains of cytochrome P₄₅₀. The genomic sequence of the apricot C4H gene was interrupted by two introns 335 bp and 904 bp long. Several regulatory motifs including P-, A-, L- and H-boxes, which were conserved across phenylpropanoid metabolism-related genes in higher plants, were found in a 1 300 bp upstream promoter region of the apricot C4H gene. A phylogenetic analysis showed that all Prunus sequences clustered together and were closely related to Malus and Rubus C4H genes. The transcription of Class I PruC4H was detected in all the examined graft combinations, which suggested its rather constitutive character.

The transcription factors CBF/DREB play an important role during low temperature, drought and high-salt stress in higher plants. A new CBF (CRT/DRE binding factor) gene was cloned from trifoliate orange [Poncirus trifoliata (L.) Raf.] by RT-PCR with degenerate primers and rapid amplification of cDNA ends (RACE) techniques. The full-length cDNA of CBF gene from trifoliate orange (designated as Ptcbfb) was 847 bp containing a 732 bp open reading frame (ORF), encoding a 243 amino acid protein. The predicted protein (designated as PtCBFb) had over 60 % identity to CBFs from some other plant species. Bioinformatical analysis showed that PtCBFb contained N-terminal bipartite nuclear targeting sequence, potential C-terminal acid domain and high conserved AP2 domain. Some other loci such as phosphorylation sites of several protein kinases, N-myristoylation site, tyrosine sulfation site and amidation site were also conserved in PtCBFb. Predicted three-dimentional structure of PtCBFb was similar to CBF from Arabidopsis thaliana. Expression pattern analysis revealed Ptcbfb expression in every tested organ, and Ptcbfb was cold induced.

To identify genes involved in the susceptibility to powdery mildew in wheat, genechip hybridization experiments were performed applying interactions between resistant and susceptible wheat cultivars and powdery mildew. Ten genes were found to express exclusively in the susceptible host after inoculation. The single cell transient expression experiments revealed that the RNA interference (RNAi) of two expressed sequence tag (EST) sequences (accession No. BQ168479 and CA648596) could enhance host resistance by 22 and 15 %, respectively. Full-length cDNA cloning revealed that they represented long non-coding RNAs (lncRNAs) and markedly accumulated during the powdery mildew primary infection.

The miR171 is a conserved microRNA (miRNA) family and has been shown to participate in plant growth and development. However, the precise function of miR171 in Pinus densata remains largely unclear. Mature miR171 sequence comparison reveals high similarity between Arabidopsis thaliana and P. densata and the pre-miR171 could fold into a characteristic stem-loop hairpin structure. Genes encoding GRAS (GAI-RGA-SCR) family transcription factors and actin binding protein were identified as targets of pde-miR171 using a modified RNA ligase mediated 5' rapid amplification of cDNA ends (RLM-RACE). Furthermore, the interaction between pde-miR171 and Arabidopsis SCL6 (SCARECROW-LIKE6) was further validated through transient co-expression of both genes in Nicotiana benthamiana leaves. Next, results of real-time quantitative PCR demonstrated that the expression of pde-miR171 was significantly up-regulated in miR171-overexpressing plants than in wild-type plants, which was inversely correlated with the expression of Arabidopsis SCL6 genes. In addition, overexpression of pde-miR171 in Arabidopsis induced larger leaves and earlier flowering under long-day conditions compared with the wild type. The findings presented here suggest that miR171 derived from a P. densata precursor together with its target gene SCL6 may play important roles in the regulation of primary root growth, leaf shape, and flowering time in plants.

To facilitate functional genomic analysis and molecular breeding of velvet ash (Fraxinus velutina Torr), the de novo sequencing was carried out by Illumina sequencing technology. The cDNA samples were prepared from eleven different tissues of velvet ash and sequenced by using the Illumina genome analyzer. Subsequently, de novo assemebly, functional annotation databases, and the screening of expressed sequence tag-simple sequence repeats (EST-SSRs) were performed by comparing with corresponding databases using BLASTx and software tools. We obtained 51 698 unigenes with an average length of 661 bp and an N50 length of 980 bp. Among all these unigenes, 41 267 (79.8 %) were annotated in the NCBI non-redundant protein database and 25 236 (48.8 %) were annotated in the Swiss-Prot database. A total of 31 546 (61.0 %) and 13 281 (25.7 %) unigenes were successfully categorized to 59 and 25 functional groups, respectively, by gene ontology categories and clusters of orthologous group categories. A total of 22 323 (43.2 %) unigenes were assigned to 128 pathways using the Kyoto encyclopedia of genes and genomes pathway database. Additionally, 3 249 EST-SSRs markers were detected in 51 698 unigenes from velvet ash. Based on 3 249 EST-SSRs markers, 1 800 primer pairs were successfully designed using Primer 3. In the 50 randomly selected primers, 48 successfully amplified fragments, and 42 showed polymorphisms. We completed a successful application of the Illumina platform to de novo transcriptome assembly of velvet ash, which has the potential to be used for discovering novel genes and further characterization of gene expression profiles.

Virus-induced gene silencing (VIGS) is a technological process in which the expression of a plant target gene is down-regulated by inoculating a plant with a recombinant virus-based vector carrying part of the coding sequence of the target gene (Baulcombe, 1999a; Burch-Smith et al., 2004). VIGS uses an RNA silencing-based defence mechanism in which double-stranded RNAs (dsRNAs) of viral origin, as templates, are processed into small interfering RNAs by Dicer-like enzymes. The resulting siRNA is incorporated into an RNA-induced silencing complex, which leads to the degradation of the RNA (viral RNA, mRNA) with sequences complementary to the siRNA. Thus, VIGS utilises foreign plant genes/targets harboured by a viral vector to produce dsRNA, a source of siRNAs that triggers RNA-mediated silencing of the corresponding target gene. VIGS has proven to be a powerful and cost-effective method for functional genomics studies in plants (Rössner et al., 2022).

As key nuclear transcription factors, the ethylene-insensitive3/EIN3-like (EIN3/EIL) proteins play important roles in ethylene signal transduction pathway in various plants. In order to better understand the role of EIN3/EILs, one EIN3-like gene (designated ZmEIL1) was isolated from maize (Zea mays L.). The full-length cDNA of ZmEIL1 was 1 999 bp in length and encoded 647 amino acids. Sequence comparison of ZmEIL1 protein with other EIN3/EILs proteins revealed high conservation of five α-helices that could form a V-shaped cleft in a 3-D model, just like AtEIL3 in Arabidopsis thaliana. This protein showed transcriptional activation and activation domain located on the 507 - 647 amino acids in yeast. Furthermore, ZmEIL1 could interact with ZmERF1 in the yeast systems, which was downstream response factor in ethylene signal transduction pathway. Its mRNA could be highly induced in maize seedlings by ethephon and 1-methylcyclopropene treatments. Meanwhile, ZmEIL1 showed relatively high expression at 20 d after pollination in maize kernel. These results show that ZmEIL1 played an important role in the growth and development by participating in ethylene signalling pathway in maize.

Moth orchids (Phalaenopsis) are among the top-traded blooming potted plants in the world. To explore mitochondrial DNA (mtDNA) markers for species identification, we located simple sequence repeats in the mtDNA of Phalaenopsis aphrodite subsp. formosana and then pre-screened them for polymorphic markers by their comparison with corresponding mtDNA regions of P. equestris. The combination of 13 selected markers located in intergenic spacers could unambiguously distinguish 15 endemic moth orchids. Five most variable markers with polymorphic information content (PIC) ≥ 0.7 could be combined to classify 18 of 19 endemic moth orchids including parental strains most commonly used in breeding programs. The sequences of four selected mtDNA regions were highly variable, and one region (MT2) could be used to completely distinguish 19 endemic moth orchids. Though mitochondrial introns were highly conserved among moth orchids, evolutionary hotspots, such as variable simple sequence repeats and minisatellite repeats, were identified as useful markers. Furthermore, a marker technology was applied to reveal the maternal inheritance mode of mtDNA in the moth orchids. Moreover, phylogenetic analysis indicates that the mtDNA was nonmonophyletic below the Phalaenopsis genus. In summary, we have revealed a set of mtDNA markers that could be used for identification and phylogenetic study of Phalaenopsis orchids.

Vacuole membrane proteins play a critical role in the regulation of plant physiological processes including normal growth and development, and responses to stresses. The killing me slowly 1 (KMS1) gene that encodes a soluble N-ethylmaleimide-sensitive fusion attachment receptor (SNARE) domain-containing vacuole membrane protein was first reported in Arabidopsis. Currently, the function of KMS1 in other plants under stress is poorly understood. In this study, we report cloning, expression, and characterization of a novel KMS1 gene in alfalfa (Medicago sativa L.), designated MsKMS1 (GenBank accession No. JX467688). The full-length cDNA of MsKMS1 was 1 396 bp and contained a complete open reading frame of 1 257 bp, which encoded a putative protein of 418 amino acids. The BLASTp analysis showed that MsKMS1 shared high amino acid sequence similarities with KMS1 from other plants such as Medicago truncatula (99 %), Cicer arietinum (89 %), Glycine max (77 %), Prunus mume (76 %), Ricinus communis (72 %), Populus euphratica (72 %), Theobroma cacao (72 %), and Arabidopsis thaliana (67 %). Transient transformation of onion (Allium cepa) bulb scale epidermal cells by biolistic bombardment showed that MsKMS1 was localized to the plasma membrane. Quantitative real-time PCR revealed that MsKMS1 expression was upregulated under different abiotic stresses (200 mM NaCl, 20 % (m/v) polyethylene glycol 6000] and 10 mg dm^-3 abscisic acid. Transgenic tobacco plants were obtained via Agrobacterium-mediated transformation and treated with 200 mM NaCl. Reverse-transcription PCR data showed that MsKMS1 was successfully transcribed and expressed in the leaves of transgenic plants. The MsKMS1-overexpressors showed a lower malondialdehyde content and maintained a higher relative water content and proline content compared with non-transgenic controls under salt stress. These results indicate that the introduction of the MsKMS1 gene could improve salt stress resistance in tobacco plants. This study reveals the role of MsKMS1 in the regulation of plant responses to abiotic stress and provides evidence for further functional studies of the KMS1 family in alfalfa.

Natural accessions of Arabidopsis thaliana exhibit a clinal variation in freezing tolerance following temperature changes across the natural habitat. Here we performed molecular evolution and population genetic analyses of homologous INDUCER OF CBF EXPRESSION1 (ICE1) and ICE2 genes, the master regulators of plant cold response. A study of ICE genes polymorphism was performed using 60 A. thaliana ecotypes grouped according to their geographic origin. The genetic diversity of ICE2 was characterized by a high number of haplotypes and an overall high diversity. The levels of nonsynonymous nucleotide polymorphism increased from a northern group southward. On the contrary, the ICE1 gene sequence was less diverse and there was no clinal variation in the sequence polymorphism. Thus, different selection forces acting on the ICE2 gene might be one of the reasons of clinal variation in freezing tolerance. This clinal variation also indicates that ICE2 is more important for a cold response than ICE1. The study of the ratio of numbers of nonsynonymous to synonymous substitutions (K_a/K_s) between A. thaliana paralogs shows that the sequence diversification and emergence of two new ICE2-specific motifs could contribute to the functional diversification of the duplicates. The K_a/K_s for ICE2 of A. thaliana and A. lyrata orthologs was an order of magnitude greater than that for the ICE1 orthologs, which suggests that the protein sequence of ICE2, an early duplicate, evolved under a weaker selective constraint. A relaxed selection on ICE2 in southern populations and more stringent in northern populations also confirmed its role in a cold resistance. The selection pressure on ICE1 might be caused by its role in the control of more essential than cold response functions.

To explore and isolate genes related to flowering and fruit development, we constructed a cDNA library from floral organs and fruitlets of Ponkan mandarin (Citrus reticulata Blanco). A total of 661 high-quality expressed sequence tags (ESTs) were generated and submitted to GenBank with the accession numbers from GO343532 to GO344192. All these ESTs were assembled into 43 contigs and 296 singletons (totally 339 unigenes). The BLAST2GO software was employed to annotate the unigenes, among which 77 ones had no significant homology with the sequences in NCBI non-redundant proteins database by BLASTX analysis. Additionally, gene ontology (GO) analysis revealed an overview of sequences distribution, which implied some specially expressed genes related to flower and fruit development. Furthermore, some abundantly expressed unigenes involved in several crucial metabolic pathways related to fruit quality were highlighted and three types of homologues of miraculin-like protein2 were analyzed by both semiquantitative RT-PCR and real-time PCR. The results showed different expression profiles of these genes, which meant that they contribute distinctly to fruit development.

Chloride channels (CLCs) play pivotal roles in plant development and anion transport. However, little research has been conducted about the CLC in fruit-bearing plants. Here we provide an insight into the evolution and expression patterns of CLC gene family members in various tissues of trifoliate orange [Poncirus trifoliata (L.) Raf.] and their responses to several treatments. Genome-wide analysis identified six PtrCLC genes. The predicted proteins had similar numbers of amino acids, but shared a low sequence identity. Phylogenetic analysis revealed that PtrCLC were classified into two separate subgroups, and PtrCLC4 and PtrCLC6 in subgroup II were more closely related to bacterial CLCs. Sequence comparison with EcCLCA from Escherichia coli reveals that PtrCLC showed amino acid divergence in anion selectivity of CLC proteins. Real time qPCR analysis shows that PtrCLC genes, particularly PtrCLC6, preferentially expressed in leaves. Nitrogen deficiency irreversibly inhibited expression of PtrCLC genes except for PtrCLC1. In contrast, NaCl stress profoundly induced expression of PtrCLC genes, particularly PtrCLC2 and PtrCLC4, both of which were also upregulated by ABA treatment. The results presented here provide a solid foundation for a future functional research on citrus CLC genes.

Dendrobium williamsonii and Dendrobium cariniferum (Orchidaceae) are endangered perennial herbs, and they are very similar in morphology. Chloroplast genome sequencing technology provides a powerful tool for molecular analysis to get more infomation for phylogenetic analysis and identification of Dendrobium species. In this study, the complete chloroplast genomes of Dendrobium williamsonii and Dendrobium cariniferum were assembled and characterized using Illumina NovaSeq 6000. The genome sizes are 159 695 and 159 479 bp, including pairs of inverted repeats (27 055 and 27 024 bp) each separated by small single-copy regions (18 451 and 18 488 bp) and large single-copy regions (87 134 and 86 943 bp). The chloroplast genome overall GC content was 37.11% and 37.13%, respectively. Each chloroplast genome encoded the same number (147) of genes, including 88 protein-coding genes, 51 tRNA genes, and 8 rRNA genes. Comparative analysis of chloroplast genomes revealed the high degree of divergence included accD-psaL and ycf4 -cemA. The phylogenetic tree showed the two Dendrobium species formed only one small clade. A pair of primers that could effectively identify the two Dendrobium species were also screened. This study will provide theoretical basis for species identification, genetic breeding, and evolution of Dendrobium.

Phenylalanine ammonia lyase (PAL) is the first enzyme in the phenylpropanoid pathway. In this study, we describe the molecular characteristics of four PAL genes (MaPAL1, MaPAL2, MaPAL3, and MaPAL4) cloned from banana (Musa acuminata L. AAA group, cv. Cavendish) using a rapid amplification of cDNA ends and real time quantitative PCR. The predicted molecular masses of corresponding PALs ranged from 70.2 to 77.3 kDa and their isoelectric points were acidic. At the amino acid level, they shared a high sequence similarity with PALs in the banana DH-Pahang (AA group) genome. Phylogenetic analysis shows that the deduced amino acid sequences of MaPALs had also a high similarity with PALs of other plant species. Expression analysis by semi-quantitative reverse transcriptase PCR reveals that these genes were differentially expressed in various tissues. Enzyme activity of PAL and expression of MaPALs in bananas were induced after infection with Fusarium oxysporum f. sp cubense Tropical Race 4. Our findings suggest that MaPALs play important roles in banana resistance to F. oxysporum.

Bupleurum chinense DC., a source of the traditional Chinese medicine Bupleuri Radix, is rich in triterpenoid saikosaponins with high pharmacological activities. The enzyme β-amyrin synthase (BAS), which converts the precursor 2,3-oxidosqualene to produce the triterpene skeleton, is crucial for the biosynthesis of triterpenoid saponins. In this study, we cloned the full-length sequence of the BAS gene from B. chinense, conducted a bioinformatics analysis, and expressed it in Saccharomyces cerevisiae to investigate its function. The cDNA of β-amyrin synthase (BcBAS, GenBank accession number: MN186093) cloned from aseptic seedlings of B. chinense was 2 307 bp with a 2 286 bp open reading frame coding for 761 amino acids. Phylogenetic analysis suggests that the BcBAS protein was closely related to the BAS proteins from Panax ginseng and Betula platyphylla. as chromatography mass spectrometry analysis showed that the enzymatic product was indeed β-amyrin, the precursor of oleanane type triterpenes. Overall, our findings lay the foundation for in-depth analysis of the biosynthesis pathway of saikosaponins.

The miR399 is a conserved microRNA (miRNA) family, and it has been characterized as an essential regulator of phosphorus transport in plants. However, the biological function of miR399 in Cunninghamia lanceolata is still largely unclear. In this study, the comparison of mature miR399 sequence revealed a high similarity between Arabidopsis thaliana and C. lanceolate, and the pre-miR399 was capable of forming a typical stem-loop hairpin structure. A gene PHOSPHATE 2 (PHO2) was identified as a target of cln-miR399 using 5' rapid amplification of cDNA ends. Furthermore, the relationship between cln-miR399 and PHO2 was further confirmed through a transient co-expression of both genes in Nicotiana benthamiana. To examine the function of miR399 in Arabidopsis, miR399-overexpressing transgenic Arabidopsis thaliana was acquired using Agrobacterium-mediated approach. Real-time PCR showed that the amount of cln-MIR399 transcripts was higher in miR399-overexpressing plants than in wild-type plants, which was accompanied with down-regulation of expression of its target gene AtPHO2. The P content was 1.40 to 1.56-fold higher in the leaves of three transgenic lines than in wild type plants. However, the P content in the roots of the three transgenic lines was 24.5 - 37.2 % less than that in wild type plants. Moreover, the transcriptions of three phosphate transporter genes (PHT1, PHT2, and PHT3) were up-regulated in roots of miR399-overexpressing Arabidopsis plants. Interestingly, the transgenic lines exhibited retarded growth under normal P conditions compared with the wild type. Our findings demonstrate that cln-miR399 may play crucial roles in P transport and plant growth via regulation of its target gene PHO2.

Arctium lappa and A. tomentosum are known medicinal plants in China. The complete chloroplast genomes from A. lappa and A. tomentosum were sequenced using Illumina sequencing technology. The total genome sizes of the complete chloroplast genomes of A. lappa and A. tomentosum were 152 767 bp and 152 688 bp, respectively, and contained a pair of inverted repeats of the same length (15,181 bp). The small single-copies were 18 584 bp and 18 582 bp, and the large single-copies were 83 821 bp and 83 744 bp, respectively. We identified and annotated 134 and 126 genes from A. lappa and A. tomentosum including, respectively, 90 and 89 protein-coding genes, 36 and 29 tRNAs, and eight rRNAs. A. lappa was found to have 10 tRNAs different from those in A. tomentosum, and A. tomentosum had three tRNAs different from those in A. lappa. There were only two types of simple sequence repeats of two species, mononucleotide and dinucleotide, and the sequences were A and T rich. In addition, the two ways of phylogenetic analysis show that the position of A. lappa and A. tomentosum is consistent within Asteraceae.

Populus euphratica belongs to Salicaceae family and grows in extreme desert environments. At present, the identification of the AP2/ERF gene family of transcription factors in Salicaceae is rare, and the role of the AP2/ERF gene family in P. euphratica under salt stress and exogenous hormones has not been reported. In this study, 197, 210, 231, 192, and 147 AP2/ERF genes were identified in P. euphratica, Populus trichocarpa, Populus deltoides, Salix sinopurpurea, and Arabidopsis thaliana, respectively. The 197 AP2/ERF gene family members of P. euphratica were divided into five subfamilies, namely, AP2 (35), RAV (5), ERF (96), DREB (65), and Soloist (1), by sequence alignment and phylogenetic analysis. In addition, these genes were scattered across 19 chromosomes. The detection of 10 motifs in the P. euphratica AP2/ERF gene family revealed that motif-8 and motif-9 only appeared in the ERF subfamily and DREB subfamily, respectively. Transcriptome data showed that PeAP2/ERF genes had different expression patterns under salt stress, abscisic acid (ABA) and gibberellic acid (GA₃) treatments, suggesting that the genes PeERF002, PeERF037, PeERF082, PeERF090, and PeAP2-14 may play important roles under salt stress and exogenous hormone treatments. This study provides a reference for the functional study of the PeAP2/ERF gene, and it also lays a foundation for the breeding strategy to improve the salt tolerance of P. euphratica.

Garlic mustard (Alliaria petiolata) is an herbaceous biennial plant native to Europe. In Ukraine, in addition to becoming a serious invader, garlic mustard can serve as a host to several viruses, which may affect agricultural crops. In view of this, the purpose of the study was to identify the virome of garlic mustard growing in Ukraine. Plant samples collected in Kyiv regions were tested for the presence of cucumber mosaic virus (CMV), turnip mosaic virus (TuMV), turnip yellow mosaic virus (TYMV), watermelon mosaic virus II (WMV), and turnip crinkle virus (TCV) by serological and/or molecular methods. According to the results found in the present study, symptomatic A. petiolata obtained in 2021 were infected with CMV (60%), TuMV (20%), or co-infected with CMV + TuMV (20%). TYMV, WMV II, and TCV were not detected in any of the collected samples. The cDNA fragments encoded the coat protein (CP) gene of CMV and TuMV were sequenced and named as CMV-Ap and TuMV-Ap, respectively. In phylogenetic analysis, the CMV-Ap closely resembled the German isolate MW582807 (Sarracenia sp.), with 99.8% nucleotide identity and belongs to subgroup II of CMV. In the phylogenetic tree, TuMV-Ap clustered with isolates AP017803, AP017764, AP017791, and JQ073722, and represented the highest identity (98.6%) to Iranian isolate IRNTRa9 (AP017803) from Rapistrum rugosum and Turkish isolate TUR49 (AP017872) from Raphanus raphanistrum. The sequences of CMV-Ap and TuMV-Ap were deposited in the GenBank under Accession Numbers MZ540213 and OM799323, respectively. The results obtained in the study indicate the important role of infected garlic mustard as alternative host and natural reservoir of CMV and TuMV from which these economically important viruses can spread to other wild and cultivated plants. This is the first molecular evidence of TuMV infection in A. petiolata from Ukraine.

Hypericin, a naphthodianthrone, has been identified as the principal active compound found in St. John's wort (Hypericum perforatum L.). To generate a gene resource for hypericin and other valuable metabolites, we generated expressed sequence tags (ESTs) from H. erectum. Analyses of the ESTs enabled us to select three cDNAs, HeHyp1, HeHyp2, and HeHyp3, evidencing significant sequence homology to Hyp-1 that were involved in hypericin biosynthesis from H. erectum. The deduced amino acid sequence of HeHyp1 cDNA exhibits 95 % identity with Hyp-1. The HeHyp2 and HeHyp3 polypeptides also exhibit 81.1 % identity with Hyp-1. The transcripts of HeHyp1, HeHyp2, and HeHyp3 were detected in the root, stem, leaf, flower, and callus cells. Study using recombinant protein suggests that Hyp-1, HeHyp2, and HeHyp3 may be involved in the biosynthetic of hypericin or other emodin derivatives.

Mitogen-activated protein kinases (MAPKs) are significant components of MAPK cascades, which play versatile roles in different transduction pathways to mediate stress adaptation. However, little information is known about post-transcriptional regulation of MAPK genes in plant under drought stress. MicroRNAs (miRNAs), a class of newly identified, short non-coding RNAs, regulate the expression of target genes in plant growth, development, and stress responses. In order to investigate the mechanism of miRNA regulating MAPK genes in potato, we identified a novel potato miRNA with the sequence CGGCCTTAATAAGATGGTGAAG and named it as stu-miR856 depending on miRNA deep sequencing and bioinformatic analysis. Target prediction indicates that it can bind to the coding sequence region of two potato MAPK-like genes, and cleavage positions of them were also effectively validated by RNA ligase-mediated 5' rapid amplification of cDNA ends assay. In addition, expressional analysis shows that stu-miR856 and its targets exhibited an opposite expression pattern: stu-miR856 expression significantly decreased while its target genes greatly increased in the different stages of drought treatment. The results indicate that a decreased expression of stu-miR856 might drive overexpression of two StMAPK genes family members, which may contribute to regulation of the drought adaptation of potato plants.

NAM, ATAF1/2, and CUC2 (NAC) proteins are plant-specific transcription factors playing essential roles in plant development and various abiotic stress responses. In the present study, we identified 173 full-length NAC genes in soybean, which were phylogenetically clustered into 15 groups (NACa - NACo). The soybean NAC genes (GmNACs) were non-randomly located across the 20 chromosomes, and 128 genes (86.5 %) were preferentially located in duplicated regions of chromosome arms, which implied long segmental duplication and contributed to evolution of the GmNAC gene family. Most GmNACs genes showed a distinct tissue-specific expression pattern and the redundant expression patterns of active duplicate genes suggested that GmNACs have been retained by substantial subfunctionalization during soybean evolution. Furthermore, active GmNACs genes that had undergone strong artificial selection during soybean domestication were identified based on selection analysis. After low nitrogen treatment, enhanced expression of some selected GmNAC genes were noticed in soybean shoot and root, which implied that GmNACs might play an important role in nitrogen metabolism. Here, we summarize the sequence and expression analysis of the NAC gene family in the soybean.

Heat shock transcription factors (Hsfs) participate in a variety of plant physiological processes including the regulation of transcription factors associated with thermotolerance. Here, a Hsf gene DcHsfA1d was identified from carnation (Dianthus caryophyllus L.). The open reading frame (ORF) of DcHsfA1d was 1 368 bp and encoded a protein of 455 amino acids with a molecular mass of 51.039 kDa and an isoelectric point of 4.94. Sequence domain prediction revealed that DcHsfA1d protein exhibited five typical functional features and motifs. The transcription of DcHsfA1d was significantly up-regulated under heat stress or ABA treatment. Yeast two-hybrid experiment indicated that DcHsfA1d and DcHsp70 physically interact with each other. Overexpression of DcHsfA1d in Arabidopsis ecotype Columbia enhanced seedling thermotolerance by increasing the activities of catalase, peroxidase, and superoxide dismutase while reducing relative electrolyte leakage, malondialdehyde content, accumulation of O₂^- and H₂O₂ and by initiating transcriptional regulation of thermal protective gene expression under heat stress. Furthermore, under salt stress, the root length and fresh mass of Arabidopsis ectopically expressing DcHsfA1d were significantly higher than those of wild type, which indicated that the salt tolerance of transgenic Arabidopsis was improved to a certain extent. In summary, DcHsfA1d was demonstrated to play a positive regulatory role in heat stress response and it might be a candidate gene for salt tolerance using genetic modification.

Thioredoxins (Trx) are small multifunctional redox proteins that contain thioredoxin conserved domain and active site WCXXC. The Trx family has an important role in multiple processes, including electron transport, seed germination, redox regulation, biotic and abiotic stresses resistance, etc. Although Trx genes have been extensively characterized in some plants, they have not been reported in peanut until now. The identification of AhTrx genes provides potential candidate genes for studying their effects and regulatory mechanisms in peanut (Arachis hypogaea L.) growth and development, especially under aluminium (Al) stress. It is also helpful to further analyze the Al resistance pathway in plants. Seventy AhTrx genes were identified using a genome-wide search method and conservative domain analysis. Then the basic physicochemical properties, phylogenetic relationship, gene structure, chromosomal localization, and promoter prediction were studied by the bioinformatic methods. Furthermore, the expressions of AhTrx genes under different Al treatment times in two peanut cultivars were tested using a real-time quantitative polymerase chain reaction. Seventy AhTrx genes were identified and characterized. Phylogenetic tree analysis showed that all AhTrx members could be classified into 9 groups with different conserved domains. Motif 1 was found to exist in every sequence, with an active site. Furthermore, the gene structures showed that the AhTrx family was complicated and changeable during evolution. The chromosomal localization indicated that the distribution and density of the Trx family on 20 peanut chromosomes were uneven. Predictive promoter analysis indicated that AhTrx proteins might play a role in phytohormones synthesis and stress response. Finally, the expression patterns of the AhTrx genes showed that every gene was differently expressed under Al treatment in different peanut cultivars, some were obvious, others had no significant difference, some were at a high level, while others were at a low level. This study systematically identifies the Trx gene family in peanut, providing some candidates for further study on its effects and regulatory mechanism under Al stress in peanut.

Globe artichoke (Cynara cardunculus L. var. scolymus) is rich in flavonoids which contribute to its health-promoting properties. With the aim of understanding the genetic control of flavonoid accumulation in artichoke, we isolated an artichoke full-length cDNA sequence encoding flavonoid 3'-hydroxylase (F3'H), a major enzyme of the flavonoid hydroxylation pattern. In silico studies confirmed that the deduced amino acid sequence of CcF3'H is highly similar to F3'Hs isolated from other Asteraceae. The Northern blot analysis demonstrated that CcF3'H was highly expressed in leaves and in specific parts of the heads. Its expression differed slightly among artichoke cultivars. The overexpression of CcF3'H in tobacco plants led to the accumulation of flavonoids and to an increase of flower colour intensity, thus identifying CcF3'H as promising candidate for genetic engineering. CcF3'H represents the first structural gene of the flavonoid biosynthesis isolated from C. cardunculus, and its characterization sheds light on the accumulation of flavonoids.