Two of the abundant transcripts encoding type 2 metallothionein (MT) proteins designated as MET2a and MET2b were selected in our previous study due to their high abundance (16.05 %) in the suppression subtractive hybridization library and their involvement in fruit development and maturation. The present study involves the isolation of the full-length cDNA encoding MET2a and MET2b from the ripening oil palm fruit mesocarp, examining their expression pattern compared to the other two previously reported type-3 MT members (MT3-A and MT3-B) in various oil palm organs including different vegetative and reproductive tissues. The full-length cDNA sequences of MET2a and MET2b were 571 and 553 bp and they were designated as EgMT2a and EgMT2b, respectively. The sequences of the EgMT2a and EgMT2b were then compared for sequence similarities in the database using both BLASTN and BLASTX programs. Their sequences were homologous (67-77 %) with several type-2 MTs in plants. All four MT encoding genes were differentially expressed in the ripening oil palm mesocarp tissues, but undetectable in the vegetative tissues examined. All MT genes examined were significantly up-regulated in the mature developmental stages of oil palm fruit mesocarp, except for EgMT2b which was expressed only at 17 weeks after anthesis. The type 2 MT proteins are related to a greater degree to the late fruit-ripening stage than the type 3 MT proteins consistent with their reported functions in homeostasis or detoxification. The findings in the present study contribute to better understanding the molecular mechanisms involved in fruit ripening in oil palm.

Downy mildew caused by Hyaloperonospora parasitica is a serious fungal disease in non-heading Chinese cabbage (Brassica campestris L. ssp. chinensis Makino). Pathogenesis-related 5 (PR-5) genes play an important role in plant resistance to disease invasion. In this study, a gene encoding pathogenesis-related 5-like (PR-5L) protein, named BcPR-5L, was successfully cloned from non-heading Chinese cabbage. The cDNA sequence of BcPR-5L is 747 bp in length. It encoded a protein of molecular mass of 25.78 kDa, an isoelectric point of 4.42, and containing 248 amino acids. Multiple sequence alignment indicated that BcPR-5L protein was highly homologous to other PR-5L proteins identified in 13 different species, with the highest homology to Brassica rapa. We analyzed the subcellular localization of BcPR- 5L protein by using onion epidermal cells and found that it is localized in the membrane. Real time quantitative PCR analyses revealed that the expression of BcPR-5L gene was significantly upregulated after H. parasitica infection, and the expression in the resistant cultivar was higher than that in the susceptible cultivar. In summary, our data suggest that BcPR-5L gene may play an important role in the resistance of non-heading Chinese cabbage to H. parasitica infection.

The aim of this work was to characterize a nucleotide sequence MK14 that originated from a plasmid library obtained via degenerate oligonucleotide primed polymerase chain reaction (DOP-PCR) amplification of laser microdissected Y-chromosomes of Silene latifolia. This sequence showed significant similarity to parts of two adjoining genes from bacterial representatives of the genus Ralstonia. MK14 sequence contains a part of a conserved domain, and phylogenetic analysis based on this region confirmed its relationship to Ralstonia-derived sequences. Genomic Southern blot analysis proved the presence of this fragment in the genome of S. latifolia. We hypothesize that this insertion is of bacterial origin, and was probably gained via horizontal gene transfer. Moreover, MK14 insertion is shared by some closely related Silene species, suggesting an ancient spontaneous transformation by an ancestor of bacteria from the genus Ralstonia.

Ent-kaurene oxidase (EKO) catalyze three sequential oxidations in the early steps of gibberellin biosynthesis pathway. In this research, a cDNA sequence of InEKO1 gene in the model short-day plant Ipomoea nil was identified. Our studies revealed that inductive conditions for flowering caused an increase in the transcriptional activity of the examined gene in the cotyledons-the main organs for the perception of the photoperiodic stimulus. In contrast, in the second half of the 16 h long inductive night and after that, a decreased amount of InEKO1 mRNA in the apexes was detected. What is more, ethylene, the key inhibitor of flower induction in I. nil, elevated the InEKO1 expression exclusively in the cotyledons between 10 and 14 h of the inductive night.

Aluminum (Al) is the main limiting factor for crop production in acidic soils. Efflux of organic acids is one of the mechanisms that determine Al-tolerance, and an Al-activated citrate transporter (multidrug and toxic compound extrusion) MATE1 gene is involved in different species. The contribution of the rye MATE1 gene (ScMATE1) depends on the rye (Secale cereale L.) cultivars and the crosses analyzed; there is no information about different rye species. The cDNA sequences, phylogenetic relationships, Al-tolerance, citrate exudation, and expression of the ScMATE1 gene were analyzed in several cultivars and wild species/subspecies of the Secale genus. Genotypes highly tolerant to Al were found within this genus. For the first time, sequences of the cDNA of the ScMATE1 gene were isolated and characterized in wild ryes. At least two copies of this gene were found likely to be related to Al-tolerance. The sequence comparison of 13 exons of ScMATE1 revealed variability between species, but also inter- and intra-cultivars. Variations were found in the Al-induced expression of ScMATE1 gene, as well as its contribution to Al-tolerance. The pattern of citrate exudation was inducible in most of the species/subspecies studied and constitutive in few. The phylogenetic analysis indicated that ScMATE1 is orthologue of two genes (HvMATE1 and TaMATE1) involved in the Al stress response in barley and wheat, respectively, but not orthologue of SbMATE, implicated in Al-tolerance in sorghum. ScMATE1 is involved in the response to Al stress in ryes, but its contribution to Al-tolerance is complex, and like in other species, there are tolerant and sensitive alleles in the different cultivars and species studied.

The aim of this study was to identify single nucleotide polymorphism (SNP) markers genetically linked to root elongation rate (RER) in sugar beet (Beta vulgaris L.). A population of 244 F₃ individuals, obtained from the cross between lines L01 (a low RER) and L18 (a high RER), was phenotyped by measuring RER of 11-d-old seedlings grown in a hydroponic culture. Two DNA bulks of 50 F₃ individuals with extreme phenotypes were used for bulk segregant analysis by restriction-associated DNA sequencing. A total of 20 376 SNPs were identified. Single nucleotide polymorphisms were filtered to reduce the number of the false positive and mapped on candidate chromosomal regions of the B. vulgaris reference genome. One of the total of SNPs selected, SNP10139, was strongly linked to RER (P < 0.01). The pattern of association between the SNP10139 genotype and RER was also evaluated on a breeding line panel comprising 40 low and 40 high RER individuals with different allele frequencies between groups (P < 0.01). The SNP10139 sequence was mapped on the B. vulgaris peptide transporter (PTR) gene, a carrier that influences root elongation in Arabidopsis thaliana. Our results suggest that SNP10139 influence RER in sugar beet, and sequence information can be used in marker-assisted selection programs.

The utility of plant tissue culture for the mass propagation of trees is well known, but continuous in vitro multiplication of plant material may increase the possibility of somaclonal variation; therefore, it is essential to evaluate the genetic integrity of regenerants from species-specific in vitro protocols prior to mass production and implementation. The objectives of this study were: 1) to determine the effect of 2,4-dichlorophenoxyacetic acid (2,4-D) concentration over two cycles of secondary somatic embryogenesis in Magnolia dealbata; and 2) to verify the genetic stability of the regenerants obtained. The embryogenic response was not significantly affected by the concentration of 2,4-D but did vary across cycles of induction. The addition of 4.52 μM 2,4-D induced the highest total number of embryos (100.5), the mean number of somatic embryos (25.1) and somatic embryos per explant (80.6). In both 2,4-D concentration (2.26 or 4.52 μM), genetic integrity between the donor and the propagated clones was 0.90, and the low genetic instability (≤ 0.10 in both PGR treatments) might be due to effect of cyclic somatic embryogenesis or the different response of the explants at stress in in vitro culture conditions. However, it is necessary to examine more cell lines and somatic embryogenesis cycles.

Programmed cell death (PCD) is a genetically controlled and conserved process in eukaryotes during development as well as in response to pathogens and other stresses. BAX inhibitor-1 (BI-1) has been implicated as an anti-PCD factor which is highly conserved in plants. Sequence of putative cucumber BI-1 protein exhibited 77.7 % identity and 91.2 % positive value with the homologue Blast BI-1 protein of Arabidopsis thaliana (AtBI-1). This highly homologous protein to the AtBI-1 protein was named CsBI-1. This protein contains an open reading frame (ORF) of 250 amino acids with a BAX inhibitor domain and five transmembrane regions conserved among members of the BI-1 family. Primers designed by the cDNA of CsBI-1gene were used for further sequencing. Cell death in cold-stored cucumber developed concomitantly with increased expression of the CsBI-1 gene and reached maximum at day 6. However, cell death accelerated significantly after 9 d when sharp decrease of the CsBI-1 expression occurred. After warming to 20 °C, expression of the CsBI-1 gene was the highest at day 3, decreased afterwards, and the lowest expression was detected at day 9 when PCD obviously appeared. The overall results indicate that CsBI-1 is cucumber homologue of Arabidopsis thaliana AtBI-1 gene. CsBI-1 is a conserved cell death suppressor induced by cold stress and a negative regulator of PCD.

The Eucalyptus globulus is one of the important forest tree species which reveals enhanced tolerance to multiple abiotic stresses. The enhanced tolerance of E. globulus against low temperature is linked to the presence of enhanced accumulation of lysine-rich dehydrin proteins. The accumulation of dehydrin protein of Mr 10 kDa in response to multiple abiotic stresses prevents cells from dehydration. It is encoded by a novel dehydrin-10 (DHN-10) gene. In the present study, we have used the DHN-10 gene of E. globulus of Pakistani origin, which was cloned in a bacterial expression vector pET30(a) and sequenced. We have found the 315 bp long coding sequence of this gene which has been enrolled as Eucalyptus GZJ-2018 DHN-10 gene under GenBank accession number MG948256.1. The in silico studies have identified several differences of this gene from the earlier enrolled DHN-10 genes: the studied gene possessed higher amphipathic character because of the presence of five additional electrically charged amino acids (two positively charged histidine, one negatively charged glutamate, and two negatively charged aspartate residues) and one extra lysine residue. The studied DHN-10 gene has been successfully expressed in the BL21-DE3 expression strain of Escherichia coli and 10 kDa protein has been detected on the nitrocellulose membrane. Our study is the first report of the sub-cloning of the DHN-10 gene and its expression outside the Eucalyptus cell.

Leaf hydraulic conductance (K_leaf) plays a significant part in plant-water regulation. In walnut leaves, K_leaf is stimulated by irradiance and closely relates to the accumulation of JrPIP2s aquaporin transcripts, but it is independent of stomatal aperture. To provide an insight into the early molecular events occurred during light-induced K_leaf, a large-scale transcriptomic analysis consisting of the cDNA-amplified fragment length polymorphism (AFLP) was carried out on walnut leaves maintained under irradiance or in darkness. Of the total 12 000 transcript-derived fragments (TDFs) obtained using cDNA-AFLP with 128 primer pairs, 187 TDFs were selected after sequencing, and only 93 (49 %) that had been ascribed known functions through BLAST searching of the GenBank databases. Most of these TDFs correspond to genes whose protein products are involved in cellular regulation (57.9 %) and global metabolism (39.8 %). To validate cDNA-AFLP expression patterns, 30 TDFs were further analyzed using real-time quantitative polymerase chain reaction. Moreover, exposure of leaves to irradiance was accompanied by the modification of the Ca²⁺-signaling pathway, ubiquitin-proteasome pathway, vesicle trafficking process and expression of multiple transcription factors.

As an initial step towards understanding the molecular mechanisms by which plants become invasive, we present here the first transcriptome analysis for an invasive weed Mikania micrantha. The analysis was based on the 75-nucleotide short reads data generated by the Illumina Genome Analyzer II system. A total of 31 131 unique sequences were assembled de novo based on 8.7 million filtered paired-end sequence reads for the transcriptome of an individual M. micrantha growing in the field. 73 % of the unique sequences showed significant similarity to existing proteins in the NCBI database, and 21 448 could be grouped based on gene ontology assignments. Of particular interest are the sequences that share homology with genes involved in genome evolution, plasticity, secondary metabolism and defense responses.

Thioredoxins are oxidoreductases that help to maintain redox homeostasis in plants under abiotic stress. In this study, a new thioredoxin gene, SikTrxh, was cloned from Saussurea involucrata (Kar. & Kir.), a perennial herb that grows in the high alpine mountains of Central Asia. Bioinformatics analysis shows that the full-length cDNA of SikTrxh consisted of 565 bp with a 354-bp open reading frame and encoded a 117 amino acid protein. Using quantitative reverse transcription (RT) PCR, we found that the expression of the SikTrxh gene was induced by salt, cold, and drought stresses, suggesting that this protein played a significant role in plant defense. Subcellular localization confirmed that the protein was localized to the mitochondria. A vector carrying SikTrxh was inserted into tobacco, and successfully modified plants were identified by RT-PCR. Physiological indicators and antioxidant enzyme activities were measured under low temperature, and salt and drought stresses. Our results show that malondialdehyde content and relative electrolyte leakage increased in both wild-type and SikTrxh-overexpressing transgenic plants; however, these increases were significantly higher in the wild-type plants than in the transgenic plants. We also found that photosystem II photoinhibition was lower in the transgenic plants than in the wild-type plants, and that activities of reactive oxygen species-scavenging enzymes were higher in the transgenic plants than in the wild-type plants. We conclude that SikTrxh can reduce toxic effects of reactive oxygen species to protect the plasma membrane, thereby increasing plant resistance to abiotic stresses.

Agarwood, the resin part of Aquilaria spp., is valued in medicine, perfumes, and incense. The most important components of agarwood are sesquiterpenes, which are produced only when a healthy tree is wounded. Agarwood sesquiterpene synthase 1 (ASS1) is one of key enzymes responsible for the biosynthesis of sesquiterpenes in Aquilaria sinensis (Lour.) Gilg, and it is a typical wound-inducible synthase. To elucidate its regulatory mechanism at the transcriptional level, a 978-bp sequence upstream of the translation initiation codon ATG of the promoter for ASS1 was cloned. Computational analysis revealed that this promoter contained many known cis-elements including several defense related transcriptional factor-binding boxes. To functionally validate the promoter, a 5' truncated fragment fused with the β-glucuronidase (GUS) reporter gene was used for generating stable transgenic Arabidopsis plants. The spatial and temporal expression patterns of GUS in transgenic Arabidopsis showed that the promoter of ASS1 was induced by mechanical wound and mainly expressed in vascular bundles. Subcellular localization showed that ASS1 localized in the nucleus and plasma membrane. Here, identification of the ASS1 promoter not only lays a foundation for studying its transcriptional regulation, but also provides clues for studying the synthesis mechanism of agarwood sesquiterpenes.

MRCTLH (muskelin/RanBPM/CTLH) is a protein complex found in humans (MRCTLH) that is involved in the regulation of numerous cellular processes, such as gluconeogenesis, cell signaling, development, nuclear extrusion, cell morphology, or stability of different proteins. According to genomic data, all eukaryotes have similar protein complexes. In yeast, a similar protein complex named GID was found to be involved in the regulation of gluconeogenesis. LICC1 is a maize protein whose sequence resembles that of TWA1 in humans and GID8 in yeast, which are central components of the MRCTLH and GID complexes. LICC1 contains three highly conserved protein domains, LisH, CTLH, and CRA, typical of this protein family. Twa1 and gid8 are unique genes in human and yeast genomes. However, three copies of licc1 are present in the maize genome and multiple copies are present in other plant genomes. This result suggests the presence of multiple variants of the MRCTLH/GID complex in plants, which could increase its regulatory capacity. We also demonstrate here that LICC1 has the ability to interact with microtubules, similarly to the human TWA1. This interaction reinforces the idea that the LICC1 protein from maize, and its homologues in plants and, in general, the GID/MRCTLH complex in plants, can perform biological functions similar to those in humans and yeast.

Tamarix ramosissima is a deciduous shrub that resides in arid and semi-arid regions. Although of ecological and medicinal values, some Tamarix species are considered invasive as they have dominated the riparian zones of dryland in some parts of the world. Here, the complete chloroplast (cp) genome of T. ramosissima was sequenced and analyzed, showing a size of 156 150 bp and a GC content of 36.5 %. The plastome displayed a typical quadripartite structure, consisting of a pair of inverted repeat (IR) regions of 26 554 bp, separated by a large single copy (LSC) region of 84 795 bp, and a small single copy (SSC) region of 18 247 bp. The cp genome encoded 130 genes, including 85 protein-coding genes, 37 tRNA genes, and 8 rRNA genes. A total of 32 repeat sequences and 64 simple sequence repeat (SSR) were identified in the plastome, and an obvious A/T bias was observed in the majority of the SSRs detected. By comparing the T. ramosissima cp genome with those of the other four Tamaricaceae species, a number of divergence hotspots were identified among these plastomes. Together with SSRs and long repeats identified, these divergence hotspots could be developed as potential molecular markers facilitating species discrimination and evolutionary studies. Using plastome sequences, we re-investigated the phylogenetic relationship among 19 species, and T. ramosissima was found to be a sister of Tamarix chinensis. Taken together, our study provides valuable genomic resources to deepen the understanding of plant photosynthetic mechanism and phylogenomics.

Phylogenetic analysis has become a common step in characterization of gene and protein sequences. However, despite the availability of numerous affordable and more-or-less intuitive software tools, construction of biologically relevant, informative phylogenetic trees remains a process involving several critical steps that are inherently non-algorithmic, i.e., dependent on decisions made by the user. These steps involve, but are not limited to, setting the aims of the phylogenetic study, choosing sequences to be analyzed, and selecting methods employed in sequence alignment construction, as well as algorithms and parameters used to construct the actual phylogenetic tree. This review aims towards providing guidance for these decisions, as well as illustrating common pitfalls and problems occurring during phylogenetic analysis of plant gene sequences.

Multiple allele-inherited male sterility has been widely used by breeders of Brassica rapa L. ssp. pekinensis, but the molecular mechanisms of male sterility are not yet clear. In this study, we isolated the full-length cDNA of a new gene (not included in the Brassica database). This gene, comprising 1 054 bp, encodes a 39.99 kDa protein with a Gly-Asp- Ser-Leu (GDSL)-lipase domain that is a member of the lipolytic protein GDSL family. The sequence of candidate gene is the most similar to extracellular lipase 6 (EXL6) of Arabidopsis and was therefore designated BrEXL6 and submitted to NCBI (accession No. JX131630.1). Reverse transcription semi-quantitative PCR and Western blot analysis showed that BrEXL6 and its encoded protein were significantly more expressed in fertile buds than in sterile buds. Quantitative PCR and in situ hybridization showed that BrEXL6 was highly expressed in the anthers of fertile buds, especially anthers at the pollen-development stages, but only weakly expressed in other tissues and floral organs of fertile plants and whole sterile plants. These results suggest that BrEXL6 is a pollen development-related gene. The results of this study provide clues for understanding the mechanisms underlying multiple allele-inherited male sterility.

Fructans play vital roles in enhancing plant abiotic stress tolerance by reducing oxidative damage, stabilizing cell membranes, improving the osmotic adjustment capacity, and lowering the freezing point. In this study, a sucrose: fructan-6-fructosyltransferase (6-SFT) gene involved in the synthesis of fructans was isolated from Dasypyrum villosum, Dv-6-SFT, using genomic walking and reverse transcription (RT)-PCR. Alignment of the cDNA sequence with its genomic counterpart showed that no introns were present in the Dv-6-SFT gene, and thus it differs from all other plant 6-SFTs that have been cloned previously. Sequence analysis showed that the cDNA of the Dv-6-SFT sequence comprised 2 175 bp with a 1 863 bp open reading frame, and its deduced protein comprised 620 amino acids with a predicted molecular mass of 68.47 kDa. The Dv-6-SFT gene was transferred into tobacco (Nicotiana tabacum L.) cv. W38 via Agrobacterium-mediated transformation. The screened plants were tested by PCR and semi-quantitative RT-PCR, and the transgenic plants were evaluated under drought, cold, and salt stresses. The Dv-6-SFT transgenic tobacco plants had higher resistance to drought, cold, and salt stress than the non-transgenic plants. Further analysis showed that the transgenic plant expressing Dv-6-SFT had increased content of saccharides and proline, but reduced content of malondialdehyde in leaves. The results of this study demonstrate that the Dv-6-SFT gene is a potential candidate for conferring abiotic stress tolerance in plants and it could be used in crop improvement breeding programs.

An extent of helper component protein (HC-Pro) sequence variability within virus population of single Czech isolate of potato virus Y^NTN (PVY^NTN) Nicola was identified by temperature-gradient gel electrophoresis (TGGE) and heteroduplex analysis. HC-Pro region was approximated with 6 pairs of primers derived from Hungarian PVY^NTN isolate (sequence AC M95491). Immunocapture reverse transcription - polymerase chain reaction (RT-PCR) was used to obtain six mixtures of individual overlapping polymerase chain reaction (PCR) products. cDNA libraries were prepared by cloning of purified PCR products in pCR-Script vector and screened by heteroduplex analyses. 15 different subfragments within the HC-Pro region were isolated and sequenced. In comparison to AC M95491, 19 nucleotide changes were identified, 13 led to amino acid (aa) changes. In comparison to available post-transcriptional gene silencing (PTGS) specific suppressor HC-Pro sequences of potyviruses we found out 4 aa changes in conserved regions.

A cDNA sequence OsMT3 was initially isolated from the subtractive cDNA library of ammonium-fed rice (Oryza sativa L.) leaves, which was further confirmed by Northern blot to be highly ammonium-up-regulated as compared to nitrate. Its full-length cDNA was cloned by RT-PCR, and in silico analysis reveals that the cDNA includes an open reading frame of 186 bp and encodes a rice metallothionein type 3 peptide. Northern blotting analysis showed that OsMT3 gene predominantly expressed in rice leaves, weakly in stems, and barely in buds and roots. The gene transcripts in leaves were significantly induced by polyethylene glycol (PEG), low temperature, NaCl and Cu²⁺, but not by Pb²⁺. Activities of three anti-oxidative enzymes (superoxide dismutase, catalase and peroxidases) and two non-enzymic antioxidants (reduced ascorbate and reduced glutathione) little differed in ammonium-and nitrate-fed rice leaves, indicating that the induced OsMT3 expression was not mediated by ammonium-elicited oxidative signals.

Ran is involved in response to external stimuli. In this study, six MsRan gene cDNA sequences were isolated from wild banana (Musa spp. AB group) from Sanming City, China. Sequence analysis reveals that MsRan3A, MsRan3A-1a, and MsRan3C contained Ran protein domains including a GTP hydrolysis domain, a RanGAP-binding domain, and an acidic tail, whereas two G boxes (G4 and G5) were absent in MsRan3A-6a. The physicochemical property of MsRan3A, MsRan3A-1a, MsRan3A-6a, and MsRan3C appeared to differ significantly. Real time quantitative PCR (qPCR) analysis indicates that MsRan3A-1, MsRan3A-5, MsRan3A-6, MsRan3A-6a, and MsRan3C-1 were expressed in roots, leaves, peduncles, bracts, flowers, peels, and pulp of the wild banana. MsRan3A-1a was expressed at extremely low levels in these tissues and was undetectable by qPCR. The MsRan genes were found to be involved in responses to a low temperature stress but with different response patterns. Furthermore, salicylic acid significantly enhanced MsRan gene expressions suggesting the involvement of these genes in salicylic acid signal transduction.

One of the largest families of transcriptional regulators contains WRKY proteins. They play important roles in plant defense responses. In this study, a novel WRKY gene, CsWRKY2, was isolated from the tea [Camellia sinensis (L.) O. Kuntze] plant. The full-length cDNA of CsWRKY2 was 2 050 bp in length and encoded a 522-amino acid peptide chain containing two typical WRKY domains and two zinc finger motifs, suggesting that CsWRKY2 was member of the WRKY group I family. A subcellular localization assay shows that CsWRKY2 was localized to the nucleus. Real time qPCR analysis shows that CsWRKY2 expression was higher in leaves than in other organs and was induced by cold (4 °C), drought stress, and exogenous abscisic acid (ABA). Additionally, ABA content was enhanced after the cold or drought stress and the effects were relieved by an ABA biosynthesis inhibitor. Furthermore, the expression of CsWRKY2 was up-regulated by exogenous ABA under the cold and drought stresses and down-regulated by an ABA biosynthesis inhibitor. Our findings indicate that CsWRKY2 played an important role in plant defense responses to the cold and drought stresses by participating in the ABA signaling pathway, downstream to ABA.

Seasonal growth is characteristic for many tree species including almond. Varying conditions during the season are responsible for growth cessation, bud set, dormancy entry, cold hardening, and bud burst. Here, we report the characterization of an almond homologue of the Arabidopsis GIGANTEA (AtGI) gene (designated as PdGI, GenBank accession No. KJ502316). We propose a role for this gene in the transition to dormancy and cold acclimation. The complementary DNA (cDNA) sequence of PdGI was 4 322 bp long and contained an open reading frame of 3 512 bp. The deduced amino acid sequence of PdGI shared 76 % identity with AtGI. The expression of PdGI at ambient day/night temperatures of 22/20 ºC was differentially regulated under a 16-h or 12-h photoperiod, increasing during the day and decreasing after dusk. However, this diurnal regulation was disrupted when plants were transferred to cold (12 ºC) conditions. In addition, we have assessed the expression of PdGI and putative almond homologues of the downstream target genes CONSTANS (PdCO-like) and FLOWERING LOCUS T (PdFT-like) in flower buds and shoots from adult trees during the bud break period in autumn and early winter. Our results show a clear increase in transcript abundance towards anthesis, suggesting a role of these genes in flower development.

In plants, many C2H2-type zinc finger transcription factors function in plant defense responses to biotic and abiotic stresses. Here, we report cloning and characterization of VvZFP11 which encoded a C2H2-type zinc finger protein (ZFP) in grapevine (Vitis vinifera). Sequence analysis shows that VvZFP11 contained one L-box, two C2H2-type zinc finger motifs and one ERF-associated amphiphilic repression (EAR) motif. The VvZFP11 localized to the nucleus and functional analysis shows that full-length VvZFP11 had no transcriptional activity, but VvZFP11 lacking the EAR motif had a strong transcriptional activity in yeast. In grapevine, expression of VvZFP11 was induced by salicylic acid and methyl jasmonate and also quickly responded to infection with Erisiphe necator. Arabidopsis thaliana plants overexpressing VvZFP11 were more resistant to Golovinomyces cichoracearum, and real time quantitative polymerase chain reaction revealed that defense-related genes AtPR1 and AtPDF1.2 were up-regulated in the overexpressing lines. These results suggest that VvZFP11 might play an important role in defense responses in grapevine.

The use of expressed sequence tag-simple sequence repeat (EST-SSR) markers might reflect the better relationship among species or cultivars than markers previously used. The first set of 30 EST-SSR was developed in hop (Humulus lupulus L.). They represent 25 gene loci with total of 1268 EST sequences. They were used for characterization of 11 hop samples and cross-amplification in Humulus japonicus Sieb. et Zucc. The number of alleles per locus ranged from two to nine. The observed and expected heterozygosities ranged from 0.182 to 0.956 and from 0.233 to 0.775, respectively. We used EST-SSR markers for cluster analysis of hop genotypes. Dendrogram well matched with genealogical and geographical data for hop genotypes.

Dehydration responsive element binding factor (DREB) is believed to be a stress-tolerance enhancer in plants. In the present study, a cold-binding factor (CBF)/DREB homologous gene NnDREB1 (XP_010242642.1) was isolated from lotus roots using rapid amplification of cDNA ends (RACE) and reverse transcription (RT)-PCR methods. Analysis of the deduced amino acid sequence and phylogeny classified NnDREB1 into the A-1 group of the DREB1 subfamily. Expression profiling using a quantitative PCR method revealed that NnRDEB1 was significantly induced by NaCl, mannitol, and polyethylene glycol, but not by low temperature and abscisic acid. To evaluate function of NnRDEB1, Arabidopsis thaliana was transformed with the NnDREB1 gene in a binary vector construct. The transgenic plants exhibited higher resistance to drought compared with the wild-type plants in terms of survival rates, dry and fresh masses, and chlorophyll content. In addition, overexpression of NnDREB1 resulted in higher germination rates compared with the wild type plants on MS medium containing mannitol. The expressions of downstream target stressrelated genes, including cold-regulated15B (COR15B), rare cold inducible 2B (RCI2B) and repeat domain 26 (RD26), were activated in the transgenic plants. Taken together, the results suggest that NnDREB1 might be an important protein in lotus root drought tolerance.

A pathogen-inducible WRKY cDNA was cloned from the leaves of watermelon (Citrullus lanatus) seedlings 24 h after inoculation with Cladosporium cucumerinum. The deduced protein of the gene, designated as ClWRKY70, was classified as a group III WRKY protein based on its single WRKY domain containing a Cys2HisCys zinc-finger motif. Its Arabidopsis thaliana sequence homologue (AtWRKY70) has been described as playing an important role in the plant defense response. ClWRKY70 gene transcripts were highly accumulated in watermelon by salicylic acid treatment, but not by jasmonic acid. By evaluating target gene expression in transgenic Arabidopsis overexpressing the ClWRKY70 gene, it is suggested that the watermelon WRKY gene may play a positive regulatory role in plant resistance against pathogen attack.

An ideal synthetic promoter can accurately regulate gene expression and the minimal cauliflower mosaic virus 35S promoter (GWSF) is an ideal synthetic pathogen-inducible promoter (SPIP) with several advantages. Three modified SPIPs, named as VGWSF, GWVSF, and GWSFV according to the arrangement of cis-elements, were optimized by inserting the dimer of a virus inducible cis-element (TTGGGAAGGAATTTCCTACT, V-box) upstream, midstream, or downstream the GWSF sequence. The three promoters were used to replace the cauliflower mosaic virus 35S promoter in the plasmid pBI121 in order to control the expression of the β-glucuronidase (gus) gene. Transformation of Arabidopsis thaliana (ecotype Col‑0) plants was performed via the Agrobacterium tumefaciens strain GV3101 by the floral dip method. The five-week-old transgenic T₃ lines were histochemically stained for GUS activity to evaluate the transcriptional properties of modified SPIPs. The VGWSF and GWVSF had low basal expressions and could not be induced by low or high temperatures and a low osmotic potential but could be induced by the tobacco mosaic virus (TMV). Although GWSFV had the highest GUS activity, it showed a substantial basal expression. After being treated with TMV, abscisic acid (ABA), salicylic acid (SA), or ethylene (Eth) for12 h, the expressions of modified SPIPs were evaluated by real-time quantitative PCR. With the basal expression of GWSF as a reference, each treatment was represented as log₂ (fold to the GWSF basal level). The basal expression of VGWSF and expressions induced by TMV, ABA, SA, and Eth were 1.39, 3.42, 6.01, 4.14, and 2.26, respectively, whereas the corresponding values of GWVSF were 1.16, 4.07, 3.72, 4.65, and 3.98, respectively, and the corresponding values of GWSFV were 4.43, 6.11, 4.83, 3.69, and 3.34, respectively. The results revealed that three modified SPIPs acquired virus induction activity due to the insertion of V-box. The V-box insertion position had a significant impact on transcription properties of modified SPIPs.

A suppression subtraction hybridization (SSH) cDNA library of alfalfa (Medicago sativa L.) cv. Zhongmu NO.1 had been constructed to identify differentially expressed genes under stress. Based on the sequence of a 460 bp expressed sequence tags (ESTs), a cDNA of 1652 bp was cloned by rapid amplification of cDNA ends (RACE) method. This gene (MsPBL) was predicted to encode a 434-amino-acid protein, which contained a Phox and Bem1 (PB1) domain. PB1 domain is a functional domain comprising about 80 amino acid residues, which exists in many signal transduction proteins and mediates dimerization in the proteins. PB1 domain is mostly involved in two cell signal transduction pathways: MAPK and NF-KB. When fused to the green fluorescent protein, we found MsPBL localization in the nucleus of onion (Allium cepa L.) epidermal cells. The transcripts of MsPBL rose significantly when alfalfa was treated with 300 mM NaCl, 0.1 mM ABA, and 20 % polyethylene glycol (PEG-6000). These results indicated that MsPBL may be functional within the nucleus as a signal transduction protein to allow alfalfa to rapidly respond to the environmental stress signals.

Cryostorage techniques have been developed to preserve the most valuable genotype from an endangered native population of Populus × canescens Aiton Sm. (grey poplar), which is located in the floodplain forest in the South Moravia region of the Czech Republic and which is difficult to propagate using cuttings. The prevailing genotype with valuable traits was selected by the simple sequence repeats method. This genotype was used to determine the most effective pre-cultivation conditions (cold hardening, and cold hardening combine with osmotic treatment) on dehydration tolerance and post-thaw recovery of the grey poplar shoot tips. The pre-cultivation and application of a modified plant vitrification solution 3 (PVS3) considerable reduced the freezable water content in shoot tips. Evaluation after eight weeks of regrowth revealed that simultaneous effect of cold and osmotic pre-treatments and application of PVS3 for 120 min enabled 93.3 ± 5.8 % recovery. The results emphasize the importance of the pre-cultivation conditions, which significantly improved the post-thaw recovery of the grey poplar explants.