biologia plantarum

International journal on Plant Life established by Bohumil Němec in 1959

Fulltext search in archive



« advanced mode »

 previous    1   2   3  4   5   6   7   8   9   10   11   12    next 

Results 61 to 90 of 355:

Analysis of LEA protein family members in Lepidium apetalum seeds and the expression of LaLEA1 in seedlings in response to abiotic stresses

Q.L. YANG, H. LU, Q. ZHOU, H.T. XIE, J.Y. LI, Z.Y. CHEN, S.C. HAN, H.P. ZHAO, H.X. ZHAO

Biologia plantarum 64:211-219, 2020 | DOI: 10.32615/bp.2019.161

To study the biological function of late embryogenesis abundant (LEA) proteins in Lepidium apetalum Willd., genes encoding LEA family proteins were identified from the seed transcriptome. The sequence most closely related to germination at a low temperature was selected and gene expressions in response to low temperature stress further studied. The results show that 27 LEA genes were expressed in seeds germinating at the low temperature: 3 genes were upregulated, 20 were downregulated, and 4 were not significantly different from controls. The most prominent of the upregulated genes, LaLEA1, contained an open reading frame of 624 bp and encoded 208 amino acids. The protein was rich in hydrophilic amino acids including threonine, alanine, glutamine, and lysine. It is predicted that the secondary structure contains α-helices and irregular curls. Real-time quantitative PCR results show that under low temperature stress, the expression of LaLEA1 was first downregulated and then upregulated rapidly, reaching its highest expression at 12 h, then the expression of LaLEA1 was reduced slightly but maintained higher than that of the non-stress group. As the expression of LaLEA1 was significantly altered in response to low temperature stress, we investigated the expression of LaLEA1 also in response to other abiotic stresses, i.e., salinity and drought. L. apetalum seedlings wilted in the early stage following NaCl or osmotic (polyethylene glycol) stresses, but recovered quickly, showing a strong tolerance. Real-time quantitative PCR results show that LaLEA1 was rapidly upregulated following salt and osmotic stresses, and its expression profile was closely related to NaCl or PEG concentrations. Expression was up to 7.9-fold higher than that of the control after 6 h of salt stress. These results suggest that L. apetalum seedlings responded quickly to salt stress. The response to osmotic stress was slightly slower; expression of LaLEA1 was 6.0-fold higher than that of the control after 12 h. Thus, LaLEA1 played an important role in abiotic stress tolerance. These results provide a basis for further analysis of the role of the LEA genes in the stress resistance of L. apetalum.

Analysis of ABC1 protein family members in Lepidium apetalum seeds and the expression of LaAbc1 in seedlings in response to abiotic stresses

Q.L. YANG, Z.Y. CHEN, H. LU, H.T. XIE, J.Y. LI, Y. DU, S.C. HAN, H.P. ZHAO, H.X. ZHAO

Biologia plantarum 64:725-735, 2020 | DOI: 10.32615/bp.2020.104

To study the biological function of activity of bcl complex (ABC1) proteins in Lepidium apetalum Willd., genes encoding ABC1 family proteins were identified from the seed transcriptome. The sequence most closely related to germination at a low temperature was selected and gene expressions in response to low temperature stress further studied. The results show that 21 ABC1 genes were expressed in seeds germinating at the low temperature: 4 genes were upregulated, 6 were downregulated, and 11 were not significantly different from controls. The results of fluorescence quantification of the low-temperature stress on the seedlings of 7-d-old L. apetalum showed that seven genes were up-regulated, six genes were down-regulated, and eight genes had no significant difference. Real-time quantitative PCR results show that under the low temperature stress, the expression of the LaAbc1-3 gene increased, but its expression decreased after some time. The expression of this gene increased again after removing the low temperature stress. The expression of LaAbc1-21 gene in L. apetalum seedlings showed a trend of decreasing first and then increasing. The LaAbc1-3 gene was insensitive to salt stress. Expression of the LaAbc1-21 gene was significantly up-regulated during the salt stress. Under osmotic stress, the expression of the LaAbc1-3 gene was down-regulated, and the expression was negatively correlated with polyethylene glycol (PEG-6000) concentration. Under the PEG-6000 treatment, the expression of the LaAbc1-21 gene was significantly up-regulated, and the expression was positively correlated with concentration. These results provide a basis for further analysis of the role of the ABC1 genes in the stress resistance of L. apetalum.

A positive regulatory role of the watermelon ClWRKY70 gene for disease resistance in transgenic Arabidopsis thaliana

S. M. Cho, E. Y. Kang, K. H. Min, Y. K. Lee, Y. C. Kim, K. Y. Yang, K. S. Kim, Y. S. Choi, B. H. Cho

Biologia plantarum 56:560-565, 2012 | DOI: 10.1007/s10535-012-0070-x

A pathogen-inducible WRKY cDNA was cloned from the leaves of watermelon (Citrullus lanatus) seedlings 24 h after inoculation with Cladosporium cucumerinum. The deduced protein of the gene, designated as ClWRKY70, was classified as a group III WRKY protein based on its single WRKY domain containing a Cys2HisCys zinc-finger motif. Its Arabidopsis thaliana sequence homologue (AtWRKY70) has been described as playing an important role in the plant defense response. ClWRKY70 gene transcripts were highly accumulated in watermelon by salicylic acid treatment, but not by jasmonic acid. By evaluating target gene expression in transgenic Arabidopsis overexpressing the ClWRKY70 gene, it is suggested that the watermelon WRKY gene may play a positive regulatory role in plant resistance against pathogen attack.

Effect of virus inducible cis-element insertion on transcription properties of improved GWSF promoter in Arabidopsis thaliana

Z.C. HUANG, H. LI

Biologia plantarum 64:320-323, 2020 | DOI: 10.32615/bp.2020.032

An ideal synthetic promoter can accurately regulate gene expression and the minimal cauliflower mosaic virus 35S promoter (GWSF) is an ideal synthetic pathogen-inducible promoter (SPIP) with several advantages. Three modified SPIPs, named as VGWSF, GWVSF, and GWSFV according to the arrangement of cis-elements, were optimized by inserting the dimer of a virus inducible cis-element (TTGGGAAGGAATTTCCTACT, V-box) upstream, midstream, or downstream the GWSF sequence. The three promoters were used to replace the cauliflower mosaic virus 35S promoter in the plasmid pBI121 in order to control the expression of the β-glucuronidase (gus) gene. Transformation of Arabidopsis thaliana (ecotype Col‑0) plants was performed via the Agrobacterium tumefaciens strain GV3101 by the floral dip method. The five-week-old transgenic T3 lines were histochemically stained for GUS activity to evaluate the transcriptional properties of modified SPIPs. The VGWSF and GWVSF had low basal expressions and could not be induced by low or high temperatures and a low osmotic potential but could be induced by the tobacco mosaic virus (TMV). Although GWSFV had the highest GUS activity, it showed a substantial basal expression. After being treated with TMV, abscisic acid (ABA), salicylic acid (SA), or ethylene (Eth) for12 h, the expressions of modified SPIPs were evaluated by real-time quantitative PCR. With the basal expression of GWSF as a reference, each treatment was represented as log2 (fold to the GWSF basal level). The basal expression of VGWSF and expressions induced by TMV, ABA, SA, and Eth were 1.39, 3.42, 6.01, 4.14, and 2.26, respectively, whereas the corresponding values of GWVSF were 1.16, 4.07, 3.72, 4.65, and 3.98, respectively, and the corresponding values of GWSFV were 4.43, 6.11, 4.83, 3.69, and 3.34, respectively. The results revealed that three modified SPIPs acquired virus induction activity due to the insertion of V-box. The V-box insertion position had a significant impact on transcription properties of modified SPIPs.

Molecular cloning and characterization of a novel stress responsive gene in alfalfa

R. Long, Q. Yang, J. Kang, Y. Chao, P. Wang, M. Wu, Z. Qin, Y. Sun

Biologia plantarum 56:43-49, 2012 | DOI: 10.1007/s10535-012-0014-5

A suppression subtraction hybridization (SSH) cDNA library of alfalfa (Medicago sativa L.) cv. Zhongmu NO.1 had been constructed to identify differentially expressed genes under stress. Based on the sequence of a 460 bp expressed sequence tags (ESTs), a cDNA of 1652 bp was cloned by rapid amplification of cDNA ends (RACE) method. This gene (MsPBL) was predicted to encode a 434-amino-acid protein, which contained a Phox and Bem1 (PB1) domain. PB1 domain is a functional domain comprising about 80 amino acid residues, which exists in many signal transduction proteins and mediates dimerization in the proteins. PB1 domain is mostly involved in two cell signal transduction pathways: MAPK and NF-KB. When fused to the green fluorescent protein, we found MsPBL localization in the nucleus of onion (Allium cepa L.) epidermal cells. The transcripts of MsPBL rose significantly when alfalfa was treated with 300 mM NaCl, 0.1 mM ABA, and 20 % polyethylene glycol (PEG-6000). These results indicated that MsPBL may be functional within the nucleus as a signal transduction protein to allow alfalfa to rapidly respond to the environmental stress signals.

Grey poplar explant acclimation to improve the dehydration tolerance and cryopreservation

E. POKORNÁ, M. FALTUS, P. MÁCHOVÁ, J. ZÁMEČNÍK, M. FULÍN

Biologia plantarum 64:119-128, 2020 | DOI: 10.32615/bp.2019.148

Cryostorage techniques have been developed to preserve the most valuable genotype from an endangered native population of Populus × canescens Aiton Sm. (grey poplar), which is located in the floodplain forest in the South Moravia region of the Czech Republic and which is difficult to propagate using cuttings. The prevailing genotype with valuable traits was selected by the simple sequence repeats method. This genotype was used to determine the most effective pre-cultivation conditions (cold hardening, and cold hardening combine with osmotic treatment) on dehydration tolerance and post-thaw recovery of the grey poplar shoot tips. The pre-cultivation and application of a modified plant vitrification solution 3 (PVS3) considerable reduced the freezable water content in shoot tips. Evaluation after eight weeks of regrowth revealed that simultaneous effect of cold and osmotic pre-treatments and application of PVS3 for 120 min enabled 93.3 ± 5.8 % recovery. The results emphasize the importance of the pre-cultivation conditions, which significantly improved the post-thaw recovery of the grey poplar explants.

Characterization of eight cytosolic sHSP genes and their expression in Capsella bursa-pastoris

P. Tao, L. Liu, J. B. Wang

Biologia plantarum 56:648-656, 2012 | DOI: 10.1007/s10535-012-0239-3

Small heat shock proteins (sHSPs) are crucial components of the plant response to heat shock. We identified and analyzed eight sHSP genes of Capsella bursa-pastoris to better understand the ability of this species to adapt. Eight genes were initially cloned and sequenced from the mature embryo cDNA pool. They belong to the cytosolic I (CI), cytosolic II (CII), and cytosolic III (CIII) subfamilies. One CI sHSP gene was homologous to that of C. rubella. Sequence analysis using 3' RACE revealed that there are two or more variable 3'-untranslated regions (UTRs) in these sHSP transcripts. The transcriptional levels of the eight sHSP genes were analyzed in different organs and developmental stages via qRT-PCR. Eight genes were significantly up-regulated in young leaves exposed to heat stress at 42 °C, and also showed differential responses to ABA treatment. We also compared expression of these genes with corresponding Arabidopsis sHSP genes and found some differences between the two species.

The classification of tetraploid wheat by phylogenetic and cytogenetic analyses

S.-Y. LI, L. XI, H.-J. LIU, W. ZHU, L.-L XU, Y. WANG, J. ZENG, X. FAN, L.-N. SHA, H.-Q. ZHANG, W.-L. QI, G.-Y. CHEN, Y.-H. ZHOU, H.-Y. KANG

Biologia plantarum 64:324-334, 2020 | DOI: 10.32615/bp.2020.013

Tetraploid wheat (Triticum turgidum L.) is an important species within the genus Triticum and harbors many desirable agronomic traits. The classification, origin, and evolution of tetraploid wheat remain confused and controversial, resulting in useless germplasm resources. Two classification systems for tetraploid wheat are widely used: 1) tetraploid wheat comprises two species; 2) all forms of tetraploid wheat are classified as one species. The present study aimed to reassess the classification of tetraploid wheat using phylogenetic analysis of nuclear rDNA internal transcribed spacer region (ITS) sequence data, fluorescence in situ hybridization (FISH) karyotyping, and observation of meiotic pairing behavior in F1 hybrids. Network analysis of ITS sequences indicates that tetraploid wheat was not closely related to other Triticeae species with the exception of Aegilops speltoides and Ae. sharonensis. Phylogenetic analysis of ITS sequences and FISH show that Triticum turgidum and T. timopheevii clustered on distinct branches, and meiotic pairing in F1 hybrids of these species showed a high frequency of univalents. Meiotic behavior of F1 hybrids among forms of T. turgidum revealed a low number of univalents (means < 2) except for T. turgidum ssp. dicoccoides. The significant variation on chromosomes 1A, 2A, 5A, 1B, 2B, 3B, and 6B in the FISH hybridization patterns were observed between T. turgidum ssp. dicoccoides and other T. turgidum accessions. Furthermore, the results of ITS phylogenetic analyses correspond closely with observations of meiotic behavior and FISH karyotyping. The present results indicate that T. turgidum and T. timopheevii are two distantly related species of different origins. Triticum turgidum ssp. dicoccoides should be maintained as a subspecies of T. turgidum whereas other forms of T. turgidum should be reclassified as varieties.

cDNA-AFLP profiling in the embryo axes during common bean germination

B. Teulat-Merah, M. -C. Morere-Le Paven, C. Ricoult, C. Aubry, D. Peltier

Biologia plantarum 55:437-447, 2011 | DOI: 10.1007/s10535-011-0108-5

cDNA-AFLP fingerprinting was used to identify genes with modulated expression during germination in common bean (Phaseolus vulgaris L.). The analysis was performed on the embryo axes. Nine time points covering the whole germination were considered and 800 transcript-derived fragments (PvTDFs) were scored. Among them, 80 % showed no changes during germination. The 97 PvTDFs showing differential expressions during germination were sequenced along with 14 constant transcripts that were randomly chosen. The expression of seven variable PvTDFs was confirmed by real-time RT-PCR. We observed that 92 % of the transcript changes, including 35 % of appearing mRNAs, took place before radicule protrusion, 0-17 h after imbibition (HAI). A major shift in gene expression was observed between 9 and 14 HAI, suggesting a key moment of cell re-programming. Sequence homologies were found for 52 % of the sequenced PvTDFs. The identified transcripts encode proteins belonging to several functional groups including transcription factors, proteins involved in storage compound hydrolysis, cell elongation or oxidative stress protection.

Unravelling genome dynamics in Arabidopsis synthetic auto and allopolyploid species

M. Bento, D. Tomás, W. Viegas, M. Silva

Biologia plantarum 59:661-670, 2015 | DOI: 10.1007/s10535-015-0536-8

Polyploidization is a major genome modification that results in plant species with multiple chromosome sets. Parental genome adjustment to co-habit a new nuclear environment results in additional innovation outcomes. We intended to assess genomic changes in polyploid model species with small genomes using inter retrotransposons amplified polymorphism (IRAP) and retrotransposon microsatellite amplified polymorphism (REMAP). Comparative analysis among diploid and autotetraploid A. thaliana and A. suecica lines with their parental lines revealed a marginal fraction of novel bands in both polyploids, and a vast loss of parental bands in allopolyploids. Sequence analysis of some remodelled bands shows that A. suecica parental band losses resulted mainly from sequence changes restricted to primer domains. Moreover, in A. suecica, both parental genomes presented rearrangement frequencies proportional to their sizes. Overall rates of genomic remodelling events detected in A. suecica were similar to those observed in species with a large genome supporting the role of retrotransposons and microsatellite sequences in the evolution of most allopolyploids.

Identification of hydrogen peroxide responsive ESTs involved in phenylethanoid glycoside biosynthesis in Cistanche salsa cell culture

J. Chen, Y. -X. Yan, Z. -G. Guo

Biologia plantarum 59:695-700, 2015 | DOI: 10.1007/s10535-015-0541-y

Hydrogen peroxide is an effective abiotic elicitor that can induce secondary metabolite biosynthesis in plants. We show that in cell suspension culture of a salt-tolerant medicinal plant Cistanche salsa, the production of bioactive components phenylethanoid glycosides (PeGs) was increased after an H2O2 treatment. To identify genes related to PeGs biosynthesis affected by H2O2, we constructed a suppression subtractive hybridization library of H2O2 responsive genes using a C. salsa cell line and identified 105 expressed sequence tags (ESTs) and 85 genes. EST library functional annotation and gene ontology analyses showed genes related to various stress responses, biosynthesis of secondary metabolites, and transcriptional regulation. Among them we identified two genes related to the PeGs biosynthesis pathway (4-coumarate coenzyme A ligase and cinnamate 4-hydroxylase), and two WRKY type transcription factors. The expressions of selected genes after the H2O2 treatment were analyzed by RT-qPCR. An early increased transcription of PeG biosynthesis pathway genes after the treatment revealed that H2O2 induced PeGs biosynthesis via up-regulation of its key genes.

Molecular cloning and phylogenetic analysis of cereal type II metacaspase cDNA from wheat

E. Piszczek, M. Dudkiewicz, M. Sobczak

Biologia plantarum 55:614, 2011 | DOI: 10.1007/s10535-011-0159-7

A new cereal type II metacaspase full-length cDNA from wheat (Triticum aestivum L.) leaves, TaeMCAII, was for the first time successfully amplified and sequenced. The full-length sequence of the TaeMCAII cDNA of 1 551 bp contains a 1 218 bp open reading frame. The deduced protein encoded by the TaeMCAII cDNA consists of 405 amino acids with a calculated molecular mass of 44 kDa and an isoelectric point of 5.29. In response to wounding or heat shock, a similar sequence of ultrastructural events including the tonoplast rupture, chromatin condensation, degradation of chloroplasts and disappearance of cytoplasm and organelles were observed using transmission electron microscopy. As the observed changes in TaeMCAII mRNA level did not occur to be statistically significant wounding-induced programmed cell death (PCD) seems to be metacaspase-independent pathway. Interestingly, in PCD caused by a heat-shock treatment, the level of TaeMCAII mRNA remained unaltered until 48 h after the stress what suggests that TaeMCAII participates in later stages of PCD triggered by heat-shock. Phylogenetic analysis enabled to classify TaeMCAII as a type II metacaspase. Finally, homology modelling of the putative three-dimensional structure of the TaeMCAII protein and a topology analysis of its probable active site were performed.

Expression of genes related to flavonoid and stilbene synthesis as affected by signaling chemicals and Botrytis cinerea in grapevines

S. Y. Ahn, S. A. Kim, K. S. Cho, H. K. Yun

Biologia plantarum 58:758-767, 2014 | DOI: 10.1007/s10535-014-0437-2

Recent studies have shown that the expression of genes related to the synthesis of flavonoids, such as the phenylalanineammonia lyase (PAL), chalcone synthase (CHS), chalcone isomerase (CHI), and stilbene synthase (STS) genes were induced in response to different signaling molecules and Botrytis cinerea inoculation in grapevine leaves. Therefore, in the present study, the nucleotide and deduced amino acid sequences of STS genes from cultivars Campbell Early and Kyoho were compared. The deduced amino acid sequences of VlKSTS12, VlKSTS11, VICESTS13, and VlKSTS1 showed 100 % homology to VlCESTS12, VlCESTS11, VICESTS24, and VlKSTS13, respectively, in Campbell Early and Kyoho. In addition, the maximum transcription was observed 6 h after chemical treatments. In Campbell Early, the transcription of PAL, CHS, and CHI was higher in leaves treated with ethephon than in those treated with hydrogen peroxide, methyl jasmonate, and salicylic acid. The PAL, CHS, and CHI genes were more induced in Campbell Early than in Kyoho. The mRNA content of STS genes started to increase at 6 h and peaked at 48 h after the treatments. In Kyoho leaves, the expression of STSs was highly up-regulated at 1 h and peaked at 6 h after the treatments. The expression of the STS genes was induced in both the cultivars in leaves inoculated with B. cinerea. STS11 and STS12 showed differential expression patterns from STS1, STS24, and STS13 in Campbell Early leaves inoculated with B. cinerea.

Cloning, identification, and expression analysis of a Dicer-Like gene family from Solanum lycopersicum

T. Wang, L. You, R. Li, D.-Q. Fu, B.-Z. Zhu, Y.-B. Luo, H.-L. Zhu

Biologia plantarum 60:410-418, 2016 | DOI: 10.1007/s10535-016-0620-8

Dicer proteins belong to the RNase III family of proteins, which are key components in small RNA biogenesis. In Solanum lycopersicum, seven Dicer-like (DCL) genes have been identified and have been named SlDCL. In this study, we cloned the full-length sequence of the SlDCL genes including untranslated regions using RNA ligase-mediated rapid amplification of cDNA ends. Our analysis indicates that 7 SlDCLs were located on 5 tomato chromosomes (6, 7, 8, 10, and 11). The gene structure of the SlDCLs covered long genomic regions and contained more than 20 exons. Phylogenetic analysis divided the seven SlDCL members into four subgroups. In general, all seven SlDCLs were expressed in all organs but more in flowers and fruits than in the other parts. Moreover, the expressions of some genes changed slightly after treatment with ethylene or 1-methylcyclopropene suggesting their likely roles in plant responses to ethylene. Our findings provide essential information on SlDCL genes in tomato and will aid in the functional classification of DCL families in plants.

Special origin of stem sequence influence the resistance of hairpin expressing plants against PVY

F. Jiang, B. Wu, C. Zhang, Y. Song, H. An, C. Zhu, F. Wen

Biologia plantarum 55:528-535, 2011 | DOI: 10.1007/s10535-011-0119-2

In this study, 16 hairpin RNA (hpRNA) vectors were constructed, each harboring 50 bp viral RNA sequence as the stem. They all targeted the coat protein (CP) gene of Potato virus Y (PVY). Virus resistance assay revealed that hairpin constructs targeting the anterior 200 bp regions of the CP gene were unable to induce virus resistance, while the 12 hpRNA constructs targeting posterior 600 bp regions induced high virus resistance up to 77.78 %. Northern blot analysis revealed that 50 bp-length hpRNA constructs could be transcribed efficiently and processed into siRNAs; however, no correlation between siRNA accumulation and degree of antiviral defense was observed. Results presented here indicated that the middle and 3' end of the CP cDNA was important for hpRNA-mediated PVY resistance, improving the design of pathogen-derived hpRNA expression cassettes for transgenic plant against viruses.

Application of internal transcribed spacers and maturase K markers for identifying Anoectochilus, Ludisia, and Ludochilus

J. -R. Chen, Y. -J. Shiau

Biologia plantarum 59:485-490, 2015 | DOI: 10.1007/s10535-015-0520-3

Internal transcribed spacer (ITS) regions and maturase K (matK) sequence polymorphisms provide an efficient tool for discrimination and conservation of genetic resources of Anoectochilus species. The objectives of this study were to develop markers specifically distinguishing A. formosanus Hayata from closely related A. koshunensis Hayata, A. roxburghii (Wall.) Lindl., and Ludisia discolor (Ker Gawl.) A. Rich. and to identify a molecular phylogenetic relationship of a new intergeneric BC1F1 hybrid - Ludochilus Jin-Chai. Specific primers for nuclear ITS regions and chloroplast matK sequences were designed and converted into cleaved amplified polymorphic sequence (CAPS) markers. Results show that the matK sequences obtained corresponded to pseudogenes and that their digestion with enzyme HinfI revealed a polymorphic pattern in A. formosanus and A. koshunensis. The pedigree of Lud. Jin-Chai, which was derived from the cross between Lus. discolor and A. formosanus, was also confirmed based on ITS and matK CAPS markers.

Isolation and characterization of a tonoplast Na+/H+ antiporter from the halophyte Nitraria sibirica

L. Wang, Y. K. Ma, N. N. Li, W. B. Zhang, H. P. Mao, X. F. Lin

Biologia plantarum 60:113-122, 2016 | DOI: 10.1007/s10535-015-0560-8

Na+/H+ exchanger (NHX)-mediated Na+ and H+ antiport is an important mechanism for salt tolerance in plants. In this study, an Na+/H+ antiporter gene, referred to as NsNHX1, was isolated from the halophyte Nitraria sibirica Pall. using degenerate polymerase chain reaction (PCR) and rapid amplification of cDNA ends (RACE). The resulting 2 182 bp NsNHX1 cDNA contained a 1 635 bp open reading frame (ORF) that encoded 544 amino acids and showed striking sequence similarity to tonoplast-localized NHXs from other plants. Subcellular localization analysis confirmed NsNHX1 to be a tonoplast-localized protein. Cis-elements described as being responsive to biotic and abiotic stresses were present in the NsNHX1 promoter region, and reverse transcription (RT)-PCR analysis confirmed that NsNHX1 expression was induced by exogenous abscisic acid (ABA), cold, and NaCl. Transcription of NsNHX1 increased sharply 3 h after treatment with 200 mM NaCl revealing that NsNHX1 responded rapidly to the salt stress. Overexpression of NsNHX1 enhanced salt tolerance in transgenic Arabidopsis thalliana L. suggesting that NsNHX1-mediated Na+ compartmentalization played an important role in enhancing plant salt tolerance.

Molecular cloning, expression, and subcellular localization of a PAL gene from Citrus reticulata under iron deficiency

H. Y. Yang, T. Dong, J. F. Li, M. Y. Wang

Biologia plantarum 60:482-488, 2016 | DOI: 10.1007/s10535-016-0625-3

Phenylalanine ammonia lyase (PAL) is a specific branch point enzyme of primary and secondary metabolism. The Citrus reticulata Blanco PAL gene was cloned and designated as CrPAL1. The cDNA sequence of CrPAL1 was 2 166 bp, encoding 721 amino acid residues. Sequence alignment indicates that CrPAL1 shared a high identity with PAL genes found in other plants. Both the dominant and catalytic active sites of CrPAL1 were similar to PAL proteins observed in Petroselinum crispum. Phylogenetic tree analysis indicates that CrPAL1 was more closely related to PALs in Citrus clementina × C. reticulata and Poncirus trifoliata than to those from other plants. Subcellular localization reveals that CrPAL1-green fluorescent protein fusion protein was specifically localized in the plasma membrane. Activity of PAL as well as CrPAL1 expression increased under Fe deficiency. A similar result was noted for total phenolic content. The root exudates of C. reticulata strongly promoted reutilization of apoplastic Fe in roots. Furthermore, Fe was more desorbed from the cell wall under Fe deficiency than in sufficient Fe supply.

Evaluating the role of wheat histone variant genes in development and response to abiotic stress in Arabidopsis

H. LV, X. CUI, P. ZHANG, Y. LI, Y. JI, Y. WANG, G. XIA, M. WANG

Biologia plantarum 63:594-600, 2019 | DOI: 10.32615/bp.2019.113

Histone variants can epigenetically regulate gene transcription through chromatin modulation. This regulation have been occasionally found in responses to abiotic stresses in plants, but their roles are not quite clear. Here, we describe 12 salt-responsive histone variant genes isolated from wheat. There was no sequence polymorphism in these 12 genes between the wheat cultivar 'JN177'and its salinity and drought tolerant derivative 'SR3' indicating that histone variant genes are highly conserved. However, these genes displayed differential patterns of transcription in 'JN177' and 'SR3'. When transformed into Arabidopsis thaliana, eight of the genes were silenced. The heterologous expression of the four active transgenes had no discernible effect on the Arabidopsis phenotype neither under control conditions nor under different abiotic stresses suggesting that histone variants could not be considered as candidate genes for molecular breeding by ectopic expression.

Genome-wide analysis of heptahelical protein (HHP) gene family and expression of BcHHP1 in response to stresses in Brassica rapa

J. Wang, F.Y. Huang, X.L. Hou, X. You

Biologia plantarum 63:219-227, 2019 | DOI: 10.32615/bp.2019.025

Heptahelical protein (HHP) signalling pathway is involved in cold acclimation responses to low temperature and other stresses. The HHP transcription factor family is the key component regulating this signalling pathway. In this study, five HHP-like genes, BcHHP1, BcHHP2, BcHHP3, BcHHP4, and BcHHP5, were isolated from non-heading Chinese cabbage (Brassica rapa ssp. chinensis cv. Suzhouqing). Multiple sequence alignment and phylogenetic analysis showed that BcHHP proteins are highly homologous to HHP proteins from Arabidopsis thaliana, Glycine max, Oryza sativa, and Zea mays. Some of these HHP proteins might share similar functions in some aspects, which might be further proved by interaction network of BcHHP genes. Furthermore, real-time quantitative PCR showed that BcHHP1 was induced under cold and salt treatments. Besides, BcHHP1 was also accumulated in response to abscisic acid and salicylic acid, indicating that BcHHP1 gene might participate in response to hormone treatments. In addition, a BcHHP1-YFP fusion protein was localized to the nucleus and cytoplasm. These results indicated that five BcHHP genes might play important roles in a functional HHP signalling pathway responding to cold treatment. This work might be useful for future functional analysis of other HHP-like genes.

Identification of candidate reference genes in tropical bamboos stable across species, tissues, and developmental stages

S. Chakraborty, S. Dutta, P. Biswas, M. Das

Biologia plantarum 63:253-261, 2019 | DOI: 10.32615/bp.2019.029

Bamboo possesses many unique physiological characteristics, but the molecular understanding of many of these processes remains poorly understood till to date. One major reason is unavailability of sufficient sequence and expression data. Selection of suitable reference genes is pivotal to initiate any gene expression analyses. Although, suitable reference genes have been identified in the temperate bamboo Phyllostachys edulis, it has not been done for tropical bamboo. In this study, expression stability of 10 candidate reference genes were investigated in 4 widely grown tropical bamboo species (Bambusa tulda, B. balcooa, B. bambos, and B. vulgaris), different organs (young leaves from flowering and non flowering culms, flag leaf (leaf just below the mature inflorescence), possible flag leaf (leaf covering the immature inflorescence), culm sheath, internode, root, rhizome, and inflorescence bud), different parts (basal, middle, and tip regions of leaf; internodes located in the basal, middle, and tip region of the branch, and developmental stages early, middle, and late inflorescence buds) by using 3 reliable computational tools (geNorm, NormFinder, and RefFinder). A universal single reference gene for normalization of gene expression data was not identified. However, the eukaryotic initiation factor 4α (eIF4α), clathirin adaptor complexes medium subunit (CAC), and nucleotide tract-binding protein (NTB) were found stable in the selected organs across different bamboo species. On the other hand, eIF4α ranked top when different organs and peptidyl prolyl cis-trans isomerase/cyclophilin (CYP), eukaryotic elongation factor 1α (eEF1α) and ubiquitin 5 (UBQ5) ranked top when different developmental stages of B. tulda were analyzed. Taken together, this study not only identifies reference gene/s that are stable across species, organs, and developmental stages of bamboo, but it also assesses the impacts of major contributing factors regulating expression stability of the reference genes.

An overexpression of the AP2/ERF transcription factor from Iris typhifolia in Arabidopsis thaliana confers tolerance to salt stress

J. WU, J. ZHANG, X. LI, J. LIU, Z. NIU, L. WANG*

Biologia plantarum 63:776-784, 2019 | DOI: 10.32615/bp.2019.082

The roles of ethylene responsive factors (ERFs) and their positive and negative regulations of abiotic stress tolerance have been widely reported. This study reports the characterization of ItERF from Iris typhifolia Kitag with respect to molecular and functional properties. The 867 bp cDNA fragment of ItERF was cloned by reverse transcription PCR from I. typhifolia. Real-time quantitative PCR revealed that ItERF expression was induced in the roots, stems, and leaves of I. typhifolia after NaCl treatment, and that ItERF expressions were significantly higher in the leaves and roots than in the stems. A green fluorescent protein marker revealed that ItERF was located to the nucleus. Plant survival and root growth of ItERF transgenic Arabidopsis thaliana L. seedlings were much better than those of the wild type under NaCl stress. Malondialdehyde content in the transgenic lines was significantly lower than that in the wild type. Growth of yeast transformants showed an enhanced tolerance to salt stress than non-transformed yeast cells. All of the results verified that the expression of ItERF had effects on plant growth under salt stress.

Physiological and molecular responses of two Chinese cabbage genotypes to heat stress

Q. SONG, F. YANG, B. CUI, J. LI, Y. ZHANG, H. LI, N. QIU, F. WANG, J. GAO

Biologia plantarum 63:548-555, 2019 | DOI: 10.32615/bp.2019.097

A comparative investigation of heat stress-mediated physiological and biochemical parameters in conjunction with the expression analysis of heat shock transcription factors (BrHSF) from two different Chinese cabbage genotypes was done to understand the mechanism of heat tolerance. Our results show that the heat-tolerant (2013-33) genotype had a smaller relative electric conductivity, a less malondialdehyde content and a higher maximal efficiency of photosystem II photochemistry than the heat-sensitive (AM160) genotype, and was able to develop the leaf head under heat stress, whereas 'AM160' flailed to develop it. The results also indicate that '2013-33' accumulated a higher amount of soluble sugars and protein under heat stress condition than 'AM160'. However, it warrants to mention that proline content and antioxidant enzymes, such as the peroxidase, catalase, and superoxide dismutase activities, in the 2013-33 genotype under HS were recorded, being significantly lower than in 'AM160'. Additionally, the expression profile of BrHSF genes was checked and classified to three main groups, (i) HS-induced HSFs expressed in both genotypes ( group I), (ii) suppressed by HS in both genotypes (groupII), and (iii) genotype-specific expression of HSFs (repressed in the AM160 heat-sensitive genotype whereas induced in the '2013-33' heat tolerance genotype; group III). Furthermore, the result of promoter analysis shows that group III BrHSFs, i.e., 23, 30, and 33 gene promoter regions possessed a difference between '2013-33' and 'AM160'. In conclusion, the results of our study identify that '2013-33' had more heat tolerance than 'AM160' because of a higher accumulation of sugar and protein and an enhanced expression of group III HSFs, and the differential response of group III HSFs to HS in these two genotypes may be because of a promoter sequence difference. The study provides us a clue towards understanding the mechanism of heat tolerance in Chinese cabbage and offers a valuable source for further improvement of heat tolerance in Chinese cabbage.

Expression profile analysis of MATE gene family in rice

J.J. HUANG, W. J. AN, K. J. WANG, T.H. JIANG, Q. REN, W.H. LIANG, H.H. WANG*

Biologia plantarum 63:556-564, 2019 | DOI: 10.32615/bp.2019.099

Multidrug and toxic compound extrusion (MATE) proteins is a newly characterized transporter family in plants. However, knowledge of this family in systematic classification, molecular evolution, and expression patterns in plants is limited. In this study, MATE gene sequence, structure, and names as well as MATE protein size and subcellular localization in rice were analyzed using bioinformatics tools, chromosome localizations, and gene clusters. The function of MATE proteins was further elucidated on a basis of phylogenetic relationships. Using available transcriptomic data, the expression pattern and function of MATE were different in the selected organs and developments stages of rice. In addition, the relative abundance of OsMATE1 transcripts increased 3 h after copper treatment and so it was identified as a candidate gene for Cu tolerance in rice. This research provided basic data for further studies on MATE genes in rice and theoretical information about the biological function of MATE proteins.

Tolerance to soil water stress by Oryza sativa cv. IR20 was improved by expression of Wsi18 gene locus from Oryza nivara

R. Kaur, A. Chakraborty, R. K. Bhunia, S. K. Sen, A. K. Ghosh

Biologia plantarum 62:129-139, 2018 | DOI: 10.1007/s10535-017-0742-7

Wild rice genotypes are rich in genetic diversity. This has potential to improve agronomic rice by allele mining for superior traits. Late embryogenesis abundant (LEA) proteins are often associated with desiccation tolerance and stress signalling. In the present study, a group 3 LEA gene, Wsi18 from the wild rice Oryza nivara was expressed under its own inducible promoter element in stress susceptible cultivated indica rice (cv. IR20). The resulting transgenic plants cultivated in a greenhouse showed enhanced tolerance to soil water deficit. Transgenic plants had higher grain yield, plant survival rate, and shoot relative water content compared to wild type (WT) IR20. Cell membrane stability index, proline and soluble sugar content were also greater in transgenic than WT plants under water stress. These results demonstrate the potential for improving SWS tolerance in agronomically important rice cultivar by incorporating Wsi18 gene from a wild rice O. nivara.

Virus-induced gene silencing in Nicotiana benthamiana triggered by heterologous gene sequences from Viola philippica

Q.X. Li, J. Wang, S. Zheng, N. Yang, K. Sun, C.Y. He

Biologia plantarum 63:153-163, 2019 | DOI: 10.32615/bp.2019.018

Virus-induced gene silencing (VIGS) is a particularly useful tool for functional genomics. In the present study, we attempted to utilize this technology to infer the function of genes from Viola philippica using a tobacco rattle virus (TRV) construct. Firstly, the phytoene desaturase gene from V. philippica (VpPDS) was silenced, and local leaf bleaching was observed but did not exhibit systemic effects, thereby limiting utilization of TRV-mediated gene silencing in the recipient plant. However, we observed systemic gene silencing in Nicotiana benthamiana when the VpPDS sequence was used as a trigger, thereby suggesting that heterologous gene sequences could elicit gene silencing. We then investigated the role of gene PISTILLATA from V. philippica (VpPI) of the B-class MADS-box gene family, which regulates the identity and development of stamens and petals. Using the coding region of VpPI as triggers, we determined the gene silencing efficiency of the corresponding GLOBOSA paralogs in N. benthamiana (NbGLO1 and NbGLO2), and we observed stamen-to-carpel transformation and distorted corollas in N. benthamiana suggesting that VpPI functioned as the NbGLO gene. However, the 3'-untranslated region (3'UTR) of VpPI and each 3'UTR of the NbGLO genes downregulated its own corresponding gene, hardly producing floral homeotic alterations. This work provides a better understanding of gene-specific probe design for gene silencing as well as shows that heterologous sequence-triggered VIGS is an efficient way to investigate functional conservation of orthologous genes.

Cloning of 9-cis-epoxycarotenoid dioxygenase gene (TaNCED1) from wheat and its heterologous expression in tobacco

S. J. Zhang, G. Q. Song, Y. L. Li, J. Gao, J. J. Liu, Q. Q. Fan, C. Y. Huang, X. X. Sui, X. S. Chu, D. Guo, G. Y. Li

Biologia plantarum 58:89-98, 2014 | DOI: 10.1007/s10535-013-0373-6

Abscisic acid (ABA) regulates plant responses to various environmental stresses. Oxidative cleavage of cis-epoxycarotenoids catalyzed by 9-cis-epoxycarotenoid dioxygenase (NCED) is the critical step in the biosynthesis of ABA in higher plants. Using a homologous cloning approach, a NCED-like gene (designated as TaNCED1) was isolated from wheat (Triticum aestivum). It contained an open reading frame of 1 848 bp and encodes a peptide of 615 amino acids. Multiple sequence alignments showed that TaNCED1 shared high identity with NCEDs from other plants. Phylogenetic analysis revealed that TaNCED1 was most closely related to a barley HvNCED1 gene. The predicted 3D structure of TaNCED1 showed high similarity with other homologues. Southern blot analysis indicated that TaNCED1 was a single copy in the genome of wheat. TaNCED1 was differentially expressed in various organs and the expression was up-regulated by low temperature, drought, NaCl, and ABA. Heterologous expression of TaNCED1 in tobacco (Nicotiana tabacum) significantly improved its drought tolerance. Under drought treatment, TaNCED1-overexpressing transgenic tobacco plants exhibited higher germination rate, higher relative water content, content of soluble sugars and of ABA when compared with the wild type plants.

Genomic structure and characterization of a lipase class 3 gene and promoter from oil palm

A. W. Nurniwalis, R. Zubaidah, A. Siti Nor Akmar, H. Zulkifli, M. A. Mohamad Arif, F. J. Massawe, K. L. Chan, G. K. A. Parveez

Biologia plantarum 59:227-236, 2015 | DOI: 10.1007/s10535-015-0500-7

Lipase class 3 is part of the triacylglycerol lipase family involved in lipid degradation, esterification, and transesterification processes in plants. In this study, a lipase class 3 gene and promoter from oil palm (Elaeis guineensis Jacq.) were isolated and characterized by Northern blot, Southern blot, oil palm genome sequence, and transient expression GUS assay. The full-length lipase class 3 (FLL1) deduced polypeptide encoded 483 amino acids and was identical to that deduced from lipase (EgLip1) cDNA (GI: 409994625). It contained the lipase consensus sequence, GxSxG motif, and a putative catalytic triad and had a 3-dimensional protein model similar to that of a lipase from Giberella zeae with a 50 % identity. The Northern blot and reverse transcription polymerase chain reaction (RT-PCR) show that FLL1 was predominantly expressed in the mesocarp and the expression increased as fruits reached maturity. A lower expression was detected in germinated seedlings and especially in roots. The expression of FLL1 was also enhanced in the mesocarp of cold treated fruits. A high oil accumulation in the mesocarp during fruit development makes this tissue a suitable target for a genetic modification, hence the isolation of the FLL1 promoter. The transient expression of the β-glucuronidase (GUS) gene driven by the FLL1 promoter detected the GUS expression in mesocarp slices, especially in vascular bundles. This suggests the potential role of using the promoter as tool to direct the expression of a transgene to the mesocarp of transgenic oil palm.

Transcription factor MdCBF1 gene increases freezing stress tolerance in transgenic Arabidopsis thaliana

Y. Xue, Y. Y. Wang, R. H. Peng, J. L. Zhen, B. Zhu, J. J. Gao, W. Zhao, H. J. Han, Q. H. Yao

Biologia plantarum 58:499-506, 2014 | DOI: 10.1007/s10535-014-0432-7

Transcription factors play vital roles in stress signal transduction and gene expression modulation. The sequence analysis shows that MdCBF1 from Malus domestica Borkh. cv. Fuji contained an AP2 core domain of 56 amino acids. By comparison of deduced amino acid sequences of CBF related proteins, we deduced that MdCBF1 is a CBF transcription factor gene which belongs to AP2/EREBP family, DREB-A1 subfamily. Further, we reported that transgenic Arabidopsis thaliana plants expressing the MdCBF1 gene exhibited stronger growth than wild type plants under freezing stress. The analysis of RT-PCR for stress-responsive genes implied that MdCBF1 over-expressing plants had a higher expression of COR15a, RD29A, and RD29B genes than wild type plants. Collectively, our results indicate that MdCBF1 might play an important role in the response of transgenic Arabidopsis plants to freezing stress.

Identification of a putative stearoyl acyl-carrier-protein desaturase gene from Saussurea involucrata

H. -L. Liu, H. -T. Shen, C. Chen, X. -R. Zhou, H. Liu, J. -B. Zhu

Biologia plantarum 59:316-324, 2015 | DOI: 10.1007/s10535-015-0487-0

Saussurea involucrata Kar. et Kir. tolerates severe abiotic stresses including cold, and the level of membrane fatty acid desaturation is associated with its cold acclimation. We discovered and characterized a full-length cDNA of stearoyl acyl-carrier-protein desaturase (sikSACPD) which encodes a protein consisted of 396 amino acids. A sequence alignment of the SikSACPD protein showed that it shares 91 and 86 % identity with the SACPDs of Carthamus tinctorius and Helianthus annuus, respectively. Semi-quantitative RT-PCR showed that the expression of sikSACPD increased in S. involucrata leaves as the temperature decreased from 20 to -10 °C. Agrobacterium tumefaciens was used to transform fatty acid biosynthesis 2 (FAB2):SikSACPD and FAB2:FAB2 constructs into tobacco to investigate resistance to a freezing stress and fatty acid composition of the transgenic plants. The FAB2:SikSACPD transgenic plants showed a slightly more resistance to the freezing stress than the FAB2:FAB2 transgenic plants and the wild-type. The proportion of oleic acid (C18:1) in the leaves of SikSACPD transgenic tobacco increased from approximately 5 to 20 % compared with the leaves of non-transgenic tobacco when both were exposed to cold stress treatments. This study demonstrates that the SikSACPD transgene, when expressed in tobacco, conferred a higher cold tolerance in comparison with that observed in non-transgenic tobacco. Thus, this gene may be a candidate for enhancing cold tolerance in other crop plants.

 previous    1   2   3  4   5   6   7   8   9   10   11   12    next