Plant growth regulators (PRG)-assisted phytoremediation is a technique that could enhance the yield of heavy metal accumulation in plant tissues. So far, a small number of experiments have helped identify three groups of plant hormones that may be useful for this purpose: auxins, cytokinins, and gibberellins. Studies have shown that these hormones positively affect the degree of accumulation of metallic impurities and improve the growth and stress resistance of plants. This review summarizes the present knowledge about PGRs' impact on phytoextraction yield.

Plants are continuously exposed to unfavorable environmental conditions, such as heat stress, which negatively affect plant growth and productivity. There is evidence that phytochromes are involved in plant response to different abiotic stresses. We investigated the possible phytochrome-dependent responses to heat stress in photomorphogenic tomato mutants aurea (au, phytochromobilin-deficient, PΦB) and high-pigment 1 (hp1, hyperresponsive to phytochrome-mediated responses), as well as the wild-type Micro-Tom (MT). In comparison with MT, reductions in photosynthetic rate promoted by a high temperature were more pronounced in au, whereas less pronounced in hp1. All genotypes subjected to the heat stress exhibited adjustments in the capture and dissipation of energy, which were indicated by increases in the initial fluorescence and decreases in the maximum photochemical efficiency of photosystem II (PS II). The effective quantum yield of PS II and the apparent electron transport rate showed greatest alterations in the au mutant. In addition, heat-triggered anatomical changes occurred in all genotypes but were most conspicuous in the au mutant, followed by MT. Thus, phytochrome-dependent mechanisms played pivotal roles in the plant responses to the heat stress, and deficiency in phytochromobilin biosynthesis enhanced the heat-induced impairment of photosynthetic performance.

Salsola laricifolia, a typical C₃-C₄ intermediate desert plant, is an important for understanding gene evolution and mechanisms for drought resistance. The reverse transcription quantitative polymerase chain reaction (RT-qPCR) is a preferred choice for gene expression studies, but it requires stable reference genes for normalization. Therefore, we tested the expression stability of five candidate reference genes in S. laricifolia: EF1α (elongation factor 1-α), ACT (actin), GAPDH (glyceraldehyde-3-phosphate dehydrogenase), TUB (tubulin), and 18S (18S ribosomal RNA). The expressions were tested in different tissues and under five stresses caused by abscisic acid (ABA), NaCl, NaHCO₃, darkness, and osmotic stress (polyethylene glycol 6000, PEG). Four commonly used software programs (geNorm, NormFinder, BestKeeper, and RefFinder) were used. The results show the following most stable reference genes: GAPDH for ABA and dark treatments; EF1a for NaCl, PEG; and all samples; TUB for NaHCO₃; and 18S for the controls. The ACT was not ranked first in any group, and was the least stable reference gene under the dark, NaHCO₃, and PEG. Moreover, pairwise analysis by the geNorm algorithm shows that two best reference genes were 18S and EF1a for the controls, GAPDH, and 18S for the ABA and dark treatments, EF1a and TUB for the NaCl treatment, TUB and 18S for the NaHCO₃ treatment, EF1a and GAPDH for the PEG treatment, and EF1a and 18S for all samples. The reference genes for RT-qPCR in S. laricifolia identified in our study will facilitate future work on targeted gene expression.

The metalloid arsenic (As) is highly phytotoxic, in part due to the similarity of the arsenates to phosphates, but also due to its ability to induce reactive oxygen species (ROS) formation, and in the form of arsenite directly interact with certain enzymes. Here we aimed to determine the effects of a short period of As exposure on Arabidopsis thaliana. Particular focus was given to shoot responses, which have received less attention in previous studies. A. thaliana (ecotype Col-0) plants (28-d-old) were cultivated hydroponically in the presence of 0, 27, 108, and 216 µM arsenic in the form of sodium arsenate for five days. Translocation of As from root to shoot increased with increasing As concentration in the medium and caused a reduction in growth. Photosynthesis was severely affected due to stomatal closure, increased ROS accumulation, and alterations in expression of genes involved in oxidative stress responses and As detoxification. Primary metabolism was also perturbed, suggesting both the direct inhibition of certain enzymes as well as active defensive responses. Overall the effects of As toxicity depended greatly on the degree of translocation from root to shoot and involved both direct effects on biological processes and secondary effects caused by the accumulation of ROS.

Drought severely limits potato yield. The aim of this work was to study a response of plantlets of four potato genotypes to polyethylene glycol (PEG 6000)-induced drought stress in both physiological and molecular levels. The drought-tolerant and drought-sensitive genotypes were identified based on plantlet growth, chlorophyll content, lipid peroxidation, free proline content, and proline metabolism-related gene expressions. We found that PEG-induced stress increased malondialdehyde (MDA) and proline content, and drought-tolerant plantlets exhibited lower MDA and proline content than sensitive genotypes. In addition, PEG up-regulated ∆-1-pyrroline-5-carboxylate synthase (P5CS) and pyrroline- 5-carboxylate reductase (P5CR) gene expressions and down-regulated pyrroline dehydrogenase (PDH) and ∆-1-pyrroline-5-carboxylate dehydrogenase (P5CDH) gene expressions. Genotype B plantlets exhibited lower P5CS and P5CR expressions and higher PDH and P5CDH expressions compared with the other plantlets. The results suggest that significant cultivar differences among potato plantlets in response to PEG-induced drought stress are exhibited in root length, MDA content, proline accumulation, and proline metabolism-related gene expressions.

Bamboo possesses many unique physiological characteristics, but the molecular understanding of many of these processes remains poorly understood till to date. One major reason is unavailability of sufficient sequence and expression data. Selection of suitable reference genes is pivotal to initiate any gene expression analyses. Although, suitable reference genes have been identified in the temperate bamboo Phyllostachys edulis, it has not been done for tropical bamboo. In this study, expression stability of 10 candidate reference genes were investigated in 4 widely grown tropical bamboo species (Bambusa tulda, B. balcooa, B. bambos, and B. vulgaris), different organs (young leaves from flowering and non flowering culms, flag leaf (leaf just below the mature inflorescence), possible flag leaf (leaf covering the immature inflorescence), culm sheath, internode, root, rhizome, and inflorescence bud), different parts (basal, middle, and tip regions of leaf; internodes located in the basal, middle, and tip region of the branch, and developmental stages early, middle, and late inflorescence buds) by using 3 reliable computational tools (geNorm, NormFinder, and RefFinder). A universal single reference gene for normalization of gene expression data was not identified. However, the eukaryotic initiation factor 4α (eIF4α), clathirin adaptor complexes medium subunit (CAC), and nucleotide tract-binding protein (NTB) were found stable in the selected organs across different bamboo species. On the other hand, eIF4α ranked top when different organs and peptidyl prolyl cis-trans isomerase/cyclophilin (CYP), eukaryotic elongation factor 1α (eEF1α) and ubiquitin 5 (UBQ5) ranked top when different developmental stages of B. tulda were analyzed. Taken together, this study not only identifies reference gene/s that are stable across species, organs, and developmental stages of bamboo, but it also assesses the impacts of major contributing factors regulating expression stability of the reference genes.

Mitogen-activated protein kinases (MAPKs) are significant components of MAPK cascades, which play versatile roles in different transduction pathways to mediate stress adaptation. However, little information is known about post-transcriptional regulation of MAPK genes in plant under drought stress. MicroRNAs (miRNAs), a class of newly identified, short non-coding RNAs, regulate the expression of target genes in plant growth, development, and stress responses. In order to investigate the mechanism of miRNA regulating MAPK genes in potato, we identified a novel potato miRNA with the sequence CGGCCTTAATAAGATGGTGAAG and named it as stu-miR856 depending on miRNA deep sequencing and bioinformatic analysis. Target prediction indicates that it can bind to the coding sequence region of two potato MAPK-like genes, and cleavage positions of them were also effectively validated by RNA ligase-mediated 5' rapid amplification of cDNA ends assay. In addition, expressional analysis shows that stu-miR856 and its targets exhibited an opposite expression pattern: stu-miR856 expression significantly decreased while its target genes greatly increased in the different stages of drought treatment. The results indicate that a decreased expression of stu-miR856 might drive overexpression of two StMAPK genes family members, which may contribute to regulation of the drought adaptation of potato plants.

Plant flotillins, a subgroup of the SPFH domain protein superfamily, consist of three proteins, AtFLOT1, AtFLOT2, and AtFLOT3 in Arabidopsis thaliana. The exact functions of flotillins in plant cell has not been established yet. In this study we focused on the role of flotillins in response to both abiotic and biotic stresses and on the response to phytohormones abscisic acid and 1-naphthalene acetic acid (NAA) in A. thaliana. We observed transcriptomic changes of AtFLOT genes in response to high salinity and cold, treatment with 22-amino acid peptide from N-terminal part of flagellin (flg22), and after infection with Botrytis cinerea. Transcription of AtFLOT2 increased up to 60 times after flg22 treatment. Also, treatment with B. cinerea increased transcription of AtFLOT1 10 times and of AtFLOT3 14 times. Furthermore, we used T-DNA knock-out single mutants for all three A. thaliana flotillins and we measured root growth in response to high salinity, cold, phosphate starvation, nitrogen starvation, and abscisic acid and NAA treatments. Subsequently, we measured the reactive oxygen species production and callose accumulation after the treatment with flg22. Next, we performed resistance assays to Pseudomonas syringae pv. tomato DC3000 and B. cinerea. In contrast to transcriptomic changes, knocking-out of only single FLOT gene did not lead to significant changes in response to all tested stresses.

Interaction between aluminum (Al) and boron (B) in Al accumulator species has not been characterized so far. In this work, tea [Camellia sinensis (L.) O. Kuntze] plants were cultivated hydroponically and treated with adequate (control) or low B supply (-B) without or with 300 μM Al (-B+Al) for 14 weeks. Growth of B-deficient plants was completely resumed by Al supplementation or even surpassed control plants regarding shoot biomass. Net photosynthetic rate was negatively influenced by the low B supply, and the Al treatment increased it up to the level of the control plants that was reflected in the higher content of saccharides. The activity of ascorbate peroxidase (APX) in the younger leaves decreased at the low B supply accompanied with an increased H₂O₂ content. The Al treatment increased the APX activity up to the level of the control plants simultaneously with the reduction of H₂O₂. Activities of superoxide dismutase (SOD) and peroxidase (POD) increased in the low B plants and the Al treatment augmented this effect. The content of malondialdehyde (MDA) in the leaves increased by low B but declined upon the Al treatment. In the Al-treated plants, the activity of nitrate reductase (NR) and the content of free α-amino acids exceeded those of the control plants, and nitrite concentration diminished. The shoot and root B content of the B-deficient plants supplemented with Al was similar with the B-sufficient ones. The results demonstrate that the up-regulation of C and N metabolism, the activation of antioxidative defense, and the enhancement of B uptake and transport were mechanisms for growth amelioration of the B-deficient plants by Al supplementation in tea.

Various physiological and biochemical parameters associated with improved salinity tolerance in the transgenic rice lines overexpressing OsCaM1-1 gene and wild-type KDML105 were compared 3 d after exposure to 150 mM NaCl. The results showed higher relative water content, relative growth rate, content of photosynthetic pigments (chlorophylls a, b, and carotenoids), DPPH scavenging activity, and activities of superoxide dismutase, catalase, ascorbate peroxidase, and glutathione reductase in the transgenic plants when compared with the wild-type and control, KDML105 transformed with blank vector, whereas H₂O₂ content, Na/K and Na/Ca ratio, lipid peroxidation, and electrolytic leakage were lower. Taken together, the OsCaM1-1 gene overexpression probably reduced salt-induced oxidative damage in the transgenic plants by enhancing the activities of antioxidant enzymes.

The roles of ethylene responsive factors (ERFs) and their positive and negative regulations of abiotic stress tolerance have been widely reported. This study reports the characterization of ItERF from Iris typhifolia Kitag with respect to molecular and functional properties. The 867 bp cDNA fragment of ItERF was cloned by reverse transcription PCR from I. typhifolia. Real-time quantitative PCR revealed that ItERF expression was induced in the roots, stems, and leaves of I. typhifolia after NaCl treatment, and that ItERF expressions were significantly higher in the leaves and roots than in the stems. A green fluorescent protein marker revealed that ItERF was located to the nucleus. Plant survival and root growth of ItERF transgenic Arabidopsis thaliana L. seedlings were much better than those of the wild type under NaCl stress. Malondialdehyde content in the transgenic lines was significantly lower than that in the wild type. Growth of yeast transformants showed an enhanced tolerance to salt stress than non-transformed yeast cells. All of the results verified that the expression of ItERF had effects on plant growth under salt stress.

Responses of rice to submergence have been extensively studied, but the molecular network behind the tolerance to this stress is still incomplete. Transcription factors (TFs) are important players in gene transcription regulation during stresses. Here, we analyzed expression of WRKY genes and morphological and anatomical changes in different rice cultivars under submergence. When they were submerged for 48 h, changes in root number, fresh and dry masses, and aerenchyma development were observed. Although accumulations of WRKY transcripts were observed in both shoots and roots, root tissues showed higher accumulation with a peak already after 6 h under submergence. Especially transcriptions of OsWRKY11 and OsWRKY56 were high, more than 100-fold in comparison with controls. The WRKY promoter analysis showed that some cis-regulatory elements could be characterized as stress-responsive elements and linked to oxygen depletion. In the promoter of OsWRKY62, two cis-regulatory elements were found: ARE and GC-motif. These elements are known to be involved in oxygen deficiency responses. In addition, the W-box cis-regulatory element, the target of WRKY transcription factors, was found in OsWRKY11, OsWRKY56, and OsWRKY62, suggesting a feedback control acting on the upregulation of WRKY transcription factors. Genes involved in the submergence stress and resulting aerenchyma development had a W-box in their promoter regions, which also suggested regulation by WRKYs. Overall, the results support the role of WRKY transcription factors in rice submergence tolerance and unveil their action in other tolerance mechanisms.

Diosgenin, mainly extracted from some Dioscorea species, is the most important starting material for the production of steroidal drugs. It is believed that diosgenin in Dioscorea is synthesized from isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP, the isomer of IPP) produced by the cytosolic mevalonate pathway. So far, the possibility of the plastidic 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway for biosynthesis of diosgenin remains unclear. The key enzyme in the MEP pathway is 1-deoxy-D-xylulose 5-phosphate-reductoisomerase (DXR, EC: 1.1.1.267). In this study, a DXR gene, named DzDXR (GenBank accession number KY131955), was isolated from Dioscorea zingiberensis. The DzDXR has an open reading frame of 1 413 bp encoding a protein of 470 amino acid residues. The function of DzDXR was verified by a colour enhancement assay in the Escherichia coli cells harbouring the plasmid pAC-BETA. Bioinformatic analyses revealed that DzDXR had a putative plastid transit peptide at the N-terminal region and was highly homologous to other plant DXRs, especially to those in monocotyledons. During the growth period of D. zingiberensis, the expression of DzDXR was found significantly high in leaves and very low in tubers, and the highest expression was observed in mature leaves in summer. In contrast to the DzDXR transcription, diosgenin was present predominantly in tubers and in minute quantities in leaves. Because diosgenin is very likely formed mainly in the cytosol of mature leaf cells of Dioscorea and the plastidic IPP and DMAPP produced by the MEP pathway can be transported into the cytosol, the consistently high expression of DzDXR detected in mature leaf of D. zingiberensis implies that the MEP pathway might play a significant role in diosgenin biosynthesis.

Zeaxanthin epoxidase (ZEP) plays important roles in plant growth and development due to its functions in abscisic acid (ABA) biosynthesis and in the xanthophyll cycle. Many studies have been exploring the roles of ZEP in seed germination and response to various environmental stresses. In this study, we reported that heterologously overexpressing the ZEP gene from Medicago sativa (MsZEP) in tobacco increased ABA content in tobacco mature seeds and negatively regulated seed germination. Enhanced ABA synthesis in seed embryo and delayed germination might also be related to the increased 9-cis-epoxycarotenoid dioxygenase (NCED6) expression. Moreover, we found that overexpression of MsZEP resulted in an increased expression of the SOMNUS gene but a decreased expression of the DNA ligase 6 gene (Lig6) suggesting that MsZEP might affect seed proteome and DNA integrity. Furthermore, enhanced chlorophyll content in transgenic tobacco seedlings overexpressing MsZEP might be due to its function in the xanthophyll cycle and ABA biosynthesis.

Aims of the present two-year study were to evaluate the feasibility and identify potential drawbacks of the greenhouse/outdoors parallel plant growth methods for investigation of the effects of various winter chilling regimes on flowering quality indicators of four Greek olive cultivars, namely Mastoidis, Amfissis, and Lefkolia Serron (originating from mountainous and colder areas) compared to cv. Koroneiki (grown mainly in plain warm areas). Groups of potted olive plants were either grown outdoors under ambient temperature or transferred into a greenhouse for one, two, or three months during winter in Crete, Greece. During the first year, chilling accumulation deficit caused a marked decrease in the number of inflorescences per plant in all four olive cultivars. In the second year, chilling accumulation deficit had a negative effect on the number of inflorescences per plant in 'Mastoidis' at 3-month greenhouse treatment but not at all in 'Koroneiki'. Chilling deficit caused an overall decrease in the number of flowers per inflorescence in both 'Koroneiki' and 'Mastoidis' as well as in the percentage of morphologically perfect flowers. The width and length of inflorescences were not affected by chilling deficit in both the cultivars. In vitro pollen germination was reduced in all greenhouse treatments in 'Koroneiki'; however, this effect was significant only after 3 month, whereas no effect was observed in 'Mastoidis'. The results of the present study may contribute to understanding olive flowering biology and selecting appropriate cultivars for new plantations according to historical meteorological data and predicted climate change scenarios.

Calmodulin-binding transcription activators (CAMTAs) play important roles in plant growth, developmental processes, and responses to abiotic and biotic factors. Recently, five CAMTA members were identified in Citrus sinensis, however, very little is known about the molecular regulation of these CAMTAs in citrus during fruit development and under abiotic stresses. In this study, the different expression profiles of CsCAMTA genes were found in different tissues and different fruit developmental stages. The CsCAMTA genes also displayed distinct expression patterns after heat, cold, salt, and drought stresses. Furthermore, the expressions of CsCAMTA genes were significantly induced by treatments with salicylic acid, methyl jasmonate, or abscisic acid. The green fluorescent protein gene fused with CsCAMTA was specifically expressed in the nucleus of Nicotiana benthamiana cells. Additionally, CsCAMTA proteins can activate or suppress DNA transcription in yeast. These findings provide helpful information for further studies of stress signals in citrus.

Thirty-six F₂ hybrid poplar (Populus trichocarpa × P. deltoides) clones were fumigated with ozone to record its effects on growth, correlate them with stomatal response and screen for ozone sensitivity. Fumigation was applied for 6 to 9 h each day for approximately 3 months at ozone concentrations of 85 to 128 μg g^-1 using open-top chambers. Height, diameter, number of leaves, stomatal conductance, transpiration rate, total biomass, biomass components and root/shoot ratios were reduced by ozone stress. Percent of leaf fall in ozone-treated plants was nearly three times higher than in control plants exposed to charcoal-filtered air. Leaf senescence, because of ozone exposure, did not appear to be associated with reduced biomass production. Some clones had a high percentage of leaf-fall with ozone exposure, but were able to maintain total biomass production near that of the control. Their response may be an example of an ability to adjust or compensate for ozone damage. There was no significant or consistent relationship between stomatal conductance and total biomass or the change in stomatal conductance as a result of ozone exposure and the change in total biomass. Taken together, these results suggest that effects of ozone on poplar growth cannot be solely correlated to changes in stomatal conductance, more physiological and biochemical parameters should be examined.

Plant responses to elicitors are the result of a series of highly modulated consecutive changes in hormones or reactive oxygen species (ROS). Abscisic acid (ABA) is a stress hormone that coordinates the complex networks of stress responses and its content is rapidly changed in response to stresses. This study evaluated the effects of application of ABA (0, 5, 25, 50, and 100 µM) to shoot cultures of lemon balm (Melissa officinalis L.) in Murashige and Skoog (MS) liquid medium on growth, H₂O₂ production, rosmarinic acid (RA) content, total phenolic compound accumulation, phenylalanine-ammonia lyase (PAL) gene expression, and PAL activity. Our results showed that all the applied concentrations of ABA decreased the growth rate of shoots. Moreover, the expression of PAL, tyrosine aminotransferase (TAT), and rosmarinic acid synthase (RAS) genes, PAL activity, and the accumulation of total phenolic compound as well as RA were increased in the ABA-treated shoots. The highest content of RA was detected in the shoots treated with 100 µM ABA. The results suggested that both the PAL- and TAT-derived pathways were induced by ABA to increase RA accumulation in the shoot cultures of lemon balm. The results revealed that application of ABA led to up-regulation of respiratory burst oxidase homolog (RBOH) expression, which was correlated with the production of H₂O₂ in the shoots cultures. In addition, the cis epoxy carotenoid dioxygenase (NCED) gene, which encodes key enzyme involved in ABA biosynthesis was up-regulated. These results demonstrated that ABA treatment enhanced endogenous ABA content and rosmarinic acid synthesis in the shoot cultures of lemon balm.

Tomato is highly sensitive to chilling stress (0 - 12 °C) which severely affects plant growth and development. Transgenic tomato plants expressing the AtDREB1A gene under the control of the rd29A promoter were evaluated for its tolerance to chilling stress by exposing them to 4 °C for 5 d. The cold stress caused an increase in production of reactive oxygen species, however, transgenic plants had an effective antioxidant system due to an enhanced synthesis of catalase (CAT), superoxide dismutase (SOD), and ascorbate and so the reduced content of hydrogen peroxide and superoxide anions. Transgenic plants showed a slightly less reduction of chlorophyll and carotenoid content compared to wild-type plants. Similarly, a higher relative water content and a less electrolyte leakage were observed in transgenic plants. Accumulation of osmoprotectants, like proline and soluble sugars, helped transgenic plants to maintain a proper osmotic balance under the cold stress. Stress-responsive genes pyrroline-5-carboxylate synthase, CAT, SOD, and lipid peroxidase showed enhanced expressions under the cold stress in transgenic plants compared to wild-type plants. A recurrent exposure to the cold stress at the reproductive stage showed even higher expressions of these genes as compared to plants exposed to the cold stress for the first time. Thus, transgenic plants showed a better adaptation to the cold stress than non-transgenic plants by acquiring the stress memory of the stress experienced at the seedling stage.

In order to understand mechanisms of ontogenic resistance to apple scab, we analyzed various aspects of young and old leaves. We have introduced an apple plants cultivation system where in vitro propagated and rooting explants produce a genetically uniform population of apple (Malus domestica cv. Idared) plants. In this work, we demonstrate that apple plants produced in our cultivation system showed susceptibility to Venturia inaequalis, the cause of apple scab disease in young leaves and resistance in old leaves, which is similar to orchard situation. Our analysis shows that the cessation of epidermal cell expansion and shape formation coincided with the onset of ontogenic resistance in older leaves. Formation of specific cuticular lamellar structures did not coincide with ontogenic resistance onset. Further, chemical composition analysis of wax from young susceptible and old resistant leaves did not reveal specific compounds involved in ontogenic resistance. Differences in homogalacturonan content in cell walls in susceptible and resistant cells as well as decreased methylesterification of pectin in resistant leaves suggest that polysaccharide composition of the cell wall may play a role in mycelium growth and nutrition.

Plants of teak (Tectona grandis L.f.) growing after transplantation to fertile soil for 5 - 6 months were subjected to water stress by withholding watering continuously for 3 weeks. The growth rates of both plants in height and developing leaves in length were unaffected during the first week after withholding watering, but they were decreased by about 50 % during the second week and became negligible during the third week of water stress treatment. The rate of leaf production and internodal elongation were also decreased in plants experienced 2 weeks of water stress. However, after rewatering, these plants regained growth potential and exhibited high rates of leaf expansion and plant growth comparable to those of well-watered plants. Diurnal course of net photosynthetic rate (PN) of plants subjected to water stress for 2 weeks was similar as that of well-watered plants. However, PN of plants subjected to water stress for 3 weeks was reduced in the afternoon. Similarly, stomatal conductance (gs) and transpiration rate (E) of plants experiencing 3-week water stress were decreased in the afternoon. Soon after rewatering, PN, gs and E reached similar values to those of well-watered plants.

Salinity adversely affects plants resulting in disruption to plant growth and physiology. Previously, it has been shown that these negative effects can be alleviated by various exogenous polyamines. However, the role of spermidine (Spd) in conferring salinity tolerance in sorghum is not well documented. The effect of exogenous Spd on the responses of sweet sorghum (Sorghum bicolor L.) seedlings to salt stress (150 mM NaCl) was investigated by measuring photosynthetic carbon assimilation, Calvin cycle enzyme activities, and the the expression of respective genes. Application of 0.25 mM Spd alleviated the negative effects of salt stress on efficiency of photosystem II and CO₂ assimilation and increased the activities of ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco) and aldolase. Salt stress significantly lowered the transcriptions of genes encoding Rubisco large subunit, Rubisco small subunit, 3-phosphoglyceric acid kinase, glyceraldehyde-3-phosphate dehydrogenase, triose-3-phosphate isomerase, fructose-1,6-bisphosphate aldolase, fructose-1,6-bisphosphate phosphatase, and sedoheptulose-1,7-bisphosphatase. However, transcriptions of genes encoding phosphoribokinase and Rubisco were up-regulated. The Spd application enhanced expressions of most of these genes. It appears Spd conferred salinity tolerance to sweet sorghum seedlings by enhancing photosynthetic efficiency through regulation of gene expressions and activities of key CO₂ assimilation enzymes.

Self-grafted and pumpkin rootstock-grafted cucumber plants were subjected to the following four treatments: 1) aerated nutrient solution alone (control), 2) nutrient solution with 10 mM Ca(NO₃)₂ (Ca), 3) nutrient solution with 90 mM NaCl (NaCl), and 4) nutrient solution with 90 mM NaCl + 10 mM Ca(NO₃)₂ (NaCl+Ca). The NaCl treatment decreased the plant dry mass and content of Ca²⁺ and K⁺ but increased the Na⁺ content in roots and shoots. Smaller changes were observed in pumpkin rootstock-grafted plants. Supplementary Ca(NO₃)₂ ameliorated the negative effects of NaCl on plant dry mass, relative growth rate (RGR), as well as Ca²⁺, K⁺, and Na⁺ content especially for pumpkin rootstock-grafted plants. Supplementary Ca(NO₃)₂ distinctly stimulated the plasma membrane (PM) H⁺-ATPase activity which supplies the energy to remove excess Na⁺ from the cells. The expressions of gene encoding PM H⁺-ATPases (PMA) and gene encoding a PM Na⁺/H⁺ antiporter (SOS1) were up-regulated when Ca(NO₃)₂ was applied. The pumpkin rootstock-grafted plants had higher PM H⁺-ATPase activity as well as higher PMA and SOS1 expressions than the self-grafted plants under NaCl + Ca treatment. Therefore, the addition of Ca²⁺ in combination with pumpkin rootstock grafting is a powerful way to increase cucumber salt tolerance.

ApKUPs are typical high-affinity potassium (K⁺) transporters of Alternanthera philoxeroides which are involved in its response to K⁺ starvation and abiotic stresses. In this study, the overexpression of ApKUP3 gene in rice resulted in enhanced K⁺ nutrition and drought tolerance of transgenic plants. Compared with wild-type (WT) plants, the transgenic plants showed a better growth performance and a strengthened K⁺ accumulation under different K⁺ supplies. The ApKUP3 overexpression in the rice plants also enhanced tolerance to a drought stress, as evidenced by a reduced leaf water loss and an increased total leaf chlorophyll content, stomatal conductance, net photosynthetic rate, and activities of superoxide dismutase, peroxidase, and ascorbate peroxidase (APX). Moreover, the transcription of genes involved in the antioxidation defense system were higher in the transgenic plants than in the WT plants upon the drought stress.

To study the effect of sucrose on the sink-source relationship in in vitro-grown plants, Cistus incanus seedlings and plantlets were grown horizontally in a two-compartment Petri dish (split dish), with the root system in one compartment and the shoot in the other. Shoots and roots were exposed to different sucrose concentrations (0-30 g dm^-3), two irradiance levels (25 and 160 µmol m^-2s^-1) and the presence or absence of a minimum medium containing minerals and vitamins (M medium). Root and shoot biomass of the seedlings was enhanced by an increase in irradiance when the growth medium was not supplemented with sucrose indicating the role of photosynthesis in biomass production. When sucrose was added to either organ growth was enhanced as well. In the presence of sucrose in the root compartment, sucrose applied to the shoot compartment enhanced growth of both organs under low irradiance, while under high irradiance, sucrose had no further additive effect. In the absence of sucrose in the root compartment, the enhancement of root biomass by sucrose added to the shoot compartment was lower under high irradiance than under low irradiance. The response of Cistus plantlets to sucrose and irradiance differed from that of seedlings, probably reflecting a greater susceptibility of the plantlets to sucrose feedback inhibition on photosynthesis and biomass accumulation. The decrease in root and shoot growth when M medium was added to the shoot compartment and the relatively better growth of these organs when the roots were supplied with minerals and the shoot with sucrose, indicate that growth of the two organs in our experimental set-up was regulated by opposing fluxes of C and nutrients.

The effects of cadmium on physiological and ultrastructural characteristics were evaluated in 6-d-old seedlings of two Brassica napus L. cultivars Zheda 619 and ZS 758. Results show that Cd at lower concentration (100 μM) stimulated the seedling growth but at higher concentration (500 μM) inhibited the growth of both cultivars, decreased content of photosynthetic pigments, activities of antioxidant enzymes, and increased the content of malondialdehyde and reactive oxygen species. Cd content in different parts of seedlings was higher in ZS 758 than in Zheda 619. Electron micrographs illustrated that 500 μM Cd severely damaged the leaf and root tip cells of both cultivars. Under Cd stress, the size and number of starch grains, plastoglobuli, and lipid bodies in the chloroplasts increased. In the root tip cells, enlarged vacuoles, diffused cell walls, and undeveloped mitochondria were detected.

Effect of nitrate availability on nitrate reduction was examined in inter-connected ramets of invasive clonal plant Eichhornia crassipes grown with two nitrate supply regimes during different clonal growth stage. Increase of nitrate availability accelerated nitrate reductase activity (NRA) in parent and offspring ramets of E. crassipes, and there was greatly different pattern in inter-connected ramets during clonal growth stage. Leaf NRA was lower in offspring than that in parent ramets in phase 1, while significantly higher leaf NRA in offspring ramets was detected during phase 2. The results indicated NRA in inter-connected ramets of E. crassipes was highly dependent on nitrate availability and growth stage.

The biological activity of cell wall-derived galactoglucomannan oligosaccharides (GGMOs) was dependent on their chemical structure. Galactosyl side chains linked to the glucomanno-core influenced their inhibition of elongation growth of pea (Pisum sativum L. cv. Tyrkys) stem segments induced by 2,4-dichlorophenoxyacetic acid (2,4-D). Reduction of the number of galactosyl side chains in GGMOs caused stimulation of the endogenous growth. Modification on the glucomanno-reducing end did not affect significantly the activity of these oligosaccharides. GGMOs inhibited also the elongation induced by indole-3-acetic acid (IAA) and gibberellic acid (GA₃). In the presence of IAA the elongation growth was inhibited to 20 - 35 % after 24 h of incubation depending on GGMOs concentrations (1 μM, 10 nM, 0.1 nM), similarly as in the presence of 2,4-D, which confirms the hypothesis of GGMOs antiauxin properties. The elongation induced by GA₃ was inhibited to 25 - 60 %, however, the time course of inhibition was different compared with IAA and 2,4-D. The highest inhibition was determined already after 6 h of incubation with a significant decrease after this time. The results indicated a competition between GGMOs and growth regulators.

A pot experiment was conducted in a greenhouse to assess the tolerance of Agropyron cristatum plants to cadmium contaminated soils (0, 5, 10, 25, 50, 100, 150, and 200 mg kg^-1) for 100 d. Results indicate that Cd in concentrations of 5-50 mg kg^-1 had no significant impact on growth, relative membrane permeability (RMP), lipid peroxidation measured as malondialdehyde (MDA) content, and chlorophyll (Chl) content relative to the control. Exposure of these plants to high concentrations of Cd (100-200 mg kg^-1) caused a small reduction in growth and Chl content and a slight enhancement of RMP and MDA content compared with the control. In addition, superoxide dismutase (SOD) and peroxidase (POD) activities show an increasing trend with the increase of Cd content in soil. The Cd content in the roots was 4.7-6.1 times higher than that in the shoots under all Cd treatments suggesting that the plant can be classified as a Cd excluder. The translocation factor was low and similar at 25-200 mg kg^-1 Cd treatments. In summary, A. cristatum plants tolerated Cd stress and might have potential for the phytoremediation of Cd contaminated soils.

The present study examined the effect of salicylic acid (SA) pre-treatment on soybean seedlings exposed to cadmium and/or UV-B stress. Dry mass, pigment content, net photosynthetic rate (P_N), stomatal conductance (g_s), and transpiration rate (E) were decreased by the Cd and/or UV-B stress. SA alleviated the adverse effects of Cd and/or UV-B on growth, pigment content, PN, and gs, but did not mitigate the inhibitory effect of Cd/UV-B on E, or that of Cd on chlorophyll fluorescence parameters. Cd and/or UV-B induced oxidative stress and increased lipid peroxidation that was significantly decreased by SA pre-treatment. The Cd and/or UV-B increased superoxide dismutase (SOD) activity, decreased peroxidase (POD) activity, and catalase (CAT) activity was mostly unaltered. SA might act as one of the potential antioxidants as well as a stabilizer of membrane integrity to improve plant resistance to the Cd and/or UV-B stress.