biologia plantarum

International journal on Plant Life established by Bohumil Němec in 1959

Fulltext search in archive



« advanced mode »

 previous    1   2   3   4   5   6  7   8   9   10   11   ...    next 

Results 151 to 180 of 1797:

Altered fatty acid composition of Nicotiana benthamiana and Nicotiana excelsior leaves under transient overexpression of the cyanobacterial desC gene

M. BERESTOVOY, O.S. PAVLENKO, A.A. TYURIN, E.N. GORSHKOVA, I.V. GOLDENKOVA-PAVLOVA

Biologia plantarum 64:167-177, 2020 | DOI: 10.32615/bp.2019.144

Transient heterologous gene expression in two model plant species, Nicotiana benthamiana and N. excelsior, has been used to study the localization of the heterologous Δ9 acyl-lipid desaturase (Δ9 desaturase) of Synechococcus vulcanus in different cell compartments and its functional activity in the cases of the cytosol, chloroplast, and endoplasmic reticulum (ER) localization. The functional activity and substrate specificity of the heterologous desaturase under the conditions of transient expression have been confirmed by comparison of fatty acid (FA) profiles. The Δ9 desaturase, responsible for the synthesis of oleic and palmitoleic acids, has also been shown to strongly promote the accumulation of polyunsaturated FAs. The results convincingly demonstrate that the Δ9 desaturase of the thermophilic cyanobacterium transiently expressed in two Nicotiana species considerably alters lipid metabolism in their leaves towards a higher FA unsaturation. The functional activity of Δ9 desaturase depends on both the model plant species, N. benthamiana or N. excelsior, and the cellular localization of the enzyme. The method of transient expression of heterologous genes in plants is highly effective, inexpensive, and not time-consuming, which makes it attractive for estimating the functional activity and/or substrate specificity of heterologous desaturases.

Leaf nutrient homeostasis and maintenance of photosynthesis integrity contribute to adaptation of the pea mutant SGECdt to cadmium

A.A. BELIMOV, I.C. DODD, V.I. SAFRONOVA, K.-J. DIETZ

Biologia plantarum 64:447-453, 2020 | DOI: 10.32615/bp.2020.061

Cadmium (Cd) is a highly toxic and widespread soil pollutant, which negatively affects various aspects of plant growth and physiology. Here, the role of photosynthesis in response to Cd was investigated in the Cd-tolerant pea (Pisum sativum L.) mutant SGECdt. The wild type SGE and the mutant SGECdt were grown in a hydroponic solution supplemented with 1, 3, or 4 µM CdCl2 for 12 d. Root and shoot biomasses of the Cd-treated SGECdt were significantly higher than of SGE. Cadmium had little effect on the quantum yield of photosystem II (φPSII) and chlorophyll content of intact leaves of both pea genotypes. However, when leaf slices were taken from Cd-exposed plants and incubated with high Cd concentrations, the SGECdt mutant showed 1.5 - 2 times higher φPSII values than SGE, with genotypic differences maximal at 0.1 and 1 mM CdCl2. In contrast, when leaf slices were taken from plants previously unexposed to Cd, both pea genotypes exhibited similar φPSII values. Cadmium content in leaves and mesophyll protoplasts of Cd-treated SGECdt were about 2 - 3 times higher than in SGE ones. The mutant leaves and mesophyll protoplasts had also higher Ca, Mg, Mn, and Zn content. Thus, SGECdt acclimated to Cd during growth in the Cd-supplemented nutrient solution by developing a molecular mechanism related to photosynthetic integrity. A higher foliar nutrient content likely allows enhanced photosynthesis by counteracting the damage of leaves caused by Cd.

Effects of 5-aminolevulinic acid on osmotic adjustment and antioxidant system in mung bean under chilling stress

J.J. ZHAO, N. ZHOU, N.J. FENG, D.F. ZHENG

Biologia plantarum 64:736-743, 2020 | DOI: 10.32615/bp.2020.101

Temperature is an important factor for growth, development, productivity and geographical distribution of many plants (Nahar et al. 2015). Chilling stress is a major abiotic stress of crop production in Northeast China. Chilling stress exposure has been shown to enhance production of reactive oxygen species (ROS) and oxidative stress occurs (Nahar et al. 2015). The ROS, which include superoxide radical (O2*-), hydrogen peroxide (H2O2), hydroxyl radical (.OH), and singlet oxygen (1O2), cause damage to structural proteins, nucleic acids, enzymes, cell membranes, and other essential molecules involved in plant metabolism (Sharma et al. 2012, Nahar et al. 2015). Plants have developed mechanisms to tolerate environmental stress conditions through various physiological adaptations, including non-enzymatic and enzymatic ROS scavenging pathways (Hossain et al. 2010, Sharma et al. 2012, Nahar et al. 2015). Non-enzymic components of the antioxidative defense system include reduced ascorbate (AsA) and reduced glutathione (GSH) as well as osmotic adjustment substances as proline, soluble sugars, and soluble proteins which protect membrane integrity and cellular components from dehydration (Özlem and Ekmekçi 2011). The enzymatic antioxidants comprise superoxide dismutase (SOD), catalase (CAT), peroxidase (POD), ascorbate peroxidase (APX), glutathione reductase (GR), etc. (Gill and Tuteja 2010, Hossain et al. 2010). These enzymes, through step-by-step reaction, scavenge ROS with AsA and GSH as electron acceptors (Gill and Tuteja 2010). Nahar et al. (2015) has established that low temperature stress increased H2O2 and MDA content. Exogenous spermidine (Spd) in low temperature treatment increases the content of AsA and GSH, decreases the content of oxidized ascorbate (DHA) and oxidized glutathione GSSG, and improves activity of APX and GR. Various strategies are being employed in order to minimize the adverse effects of environmental stresses in plants. Exogenously applied plant growth regulators (PGRs) is an effective, facile, and practical technique to enhance tolerance of crops, and this approach has been used widely in recent years. One of the PGRs is 5-aminolevulinic acid, or 5-amino-4-oxo-pentanoic acid (ALA), which has a relative molecular mass of 131, and it is an essential precursor of tetrapyrrole compounds including chlorophyll, heme, and phytochrome (Balestrasse et al. 2010) and its formation may be the rate limiting step. Hotta et al. (1997a,b) observed that low dosage of ALA has plant growth regulator properties, such as promoting chlorophyll biosynthesis and enhancing photosynthesis (Memon et al. 2009), responding to environmental stresses (Korkmaz and Korkmaz 2009, Korkmaz et al. 2010, Zhang et al. 2012, Dan et al. 2013, Fu et al. 2016), and promoting recovery of growth after herbicide applications (Zhang et al. 2008). High dosages of ALA can cause the accumulation of several chlorophyll synthesis intermediates, but also production of ROS leading to oxidative stress (Balestrasse et al. 2010). Materials and methods Plants and chilling stress: Mung be

Preparation of vectors with metallothionein gene enriched by additional metal binding domain and their transient expression in Nicotiana tabacum

J. Fišer, M. Sura-De Jong, T. Macek

Biologia plantarum 59:394-398, 2015 | DOI: 10.1007/s10535-015-0485-2

The issue of finding plants suitable for phytoremediation of inorganic contaminants can be addressed through the preparation of genetically modified plants with an increased metal accumulation potential. A HisCUP gene, which encodes for a yeast metallothionein fused with a polyhistidine tail (His), was chosen for preparation of two plant vectors. These two plant vectors were constructed and a HisCUP gene expression was subsequently investigated. We firstly prepared a vector pNOV2819/RbcS/HisCUP which enabled selection on a mannose medium and contained the HisCUP gene under an inducible Rubisco promoter. Secondly, we designed a vector pGreen0029/35S/HisCUP which enabled selection of plants on a medium with kanamycin and carried the HisCUP gene under a constitutive CaMV 35S promoter. The transient expression of the HisCUP gene in tobacco plants was confirmed at RNA and protein levels for both constructs. The relative expression of the HisCUP gene was determined by semi-quantitative real-time PCR; a higher expression was detected for the vector pNOV2819/RbcS/HisCUP.

A novel DREB transcription factor from Halimodendron halodendron leads to enhance drought and salt tolerance in Arabidopsis

J. -T. Ma, C. -C. Yin, Q. -Q. Guo, M. -L. Zhou, Z. -L. Wang, Y. -M. Wu

Biologia plantarum 59:74-82, 2015 | DOI: 10.1007/s10535-014-0467-9

A new member of the APETALA2/ethylene responsive element binding protein (AP2/EREBP) transcription factor family, HhDREB2, was isolated from Halimodendron halodendron. Based on the similarity of the AP2/ERF domain, HhDREB2 was classified into A-5 group of the DREB subfamily. The expression of HhDREB2 gene was induced by drought, high salinity, and low temperature, but not by exogenous plant hormones. Trans-activity assay demonstrated that HhDREB2 gene encodes a transcription activator. Furthermore, over-expression of HhDREB2 gene under the stress-inducible rd29A promotor in Arabidopsis resulted in enhanced tolerance to salt and drought stresses. The overall results reveal that HhDREB2 functioned as important transcription factor in regulation of stress-responsive signaling in plants and may be used for improving plant tolerance to abiotic stresses.

The functions of plant cation/proton antiporters

W. Dong, D.-L. Li, N.-W. Qiu, Y.-G. Song

Biologia plantarum 62:421-427, 2018 | DOI: 10.1007/s10535-018-0790-7

The cation/H+ exchange is a basic process in transmembrane transport. The acquisition of genome sequences has now established that plants possess genes encoding a large number of cation/proton antiporter 1 (CPA1) proteins, few of which have been characterized with respect to their contribution to ion homeostasis. The CPA1s comprise plasma membrane, vacuolar, and endosomal forms, and they have been identified as important for a salinity tolerance. They are, however, also involved in both the control of cellular pH and K+ homeostasis, and regulate processes over a wide range of physiological events, from vesicle trafficking to development.

Identification and comparative analysis of aluminum-induced microRNAs conferring plant tolerance to aluminum stress in soybean

S. C. Huang, G. H. Lu, C. Y. Tang, Y. J. Ji, G. S. Tan, D. Q. Hu, J. Cheng, G. H. Wang, J. L. Qi, Y. H. Yang

Biologia plantarum 62:97-108, 2018 | DOI: 10.1007/s10535-017-0752-5

Aluminum (Al) toxicity in acidic soils is a major factor restricting crop production. Although the molecular mechanisms of Al responses have been extensively investigated, microRNA (miRNA) mediated differential Al tolerance in different soybean genotypes remains largely unknown. In this study, two soybean [Glycine max (L.) Merr.] genotypes, Al-tolerant BX10 and Al-sensitive BD2, were treated with 0 and 50 μM AlCl3 and then used to construct the miRNA libraries for deep sequencing. Results revealed 453 miRNAs, whose expression patterns were affected by Al stress. We also identified 32 differentially expressed miRNAs: 19 in BX10, 7 in BD2, and 6 in both genotypes. The gene ontology analysis of their putative target genes indicated that stress-responsive genes and amino-acid-metabolism-related processes preferentially existed in BX10. Comprehensive analysis demonstrated that conserved miRNAs, such as gma-miR166k/o, gma-miR390g, and gma-miR396c/k, mediated root elongation in BX10, whereas gma-miR169r triggered oxidative stress in BD2. These processes could be regarded as important mechanisms conferring differential Al tolerance in BX10 and BD2. This study provided new insights into different Al response mechanisms in various soybean genotypes.

Multifunctional proline rich proteins and their role in regulating cellular proline content in plants under stress

R.S. GUJJAR, A.D. PATHAK, S.G. KARKUTE, K. SUPAIBULWATANA

Biologia plantarum 63:448-454, 2019 | DOI: 10.32615/bp.2019.078

Proline rich proteins (PRPs), earlier famous as animal salivary proteins, have now been proven as indispensable plant proteins. They are highly rich in proline amino acid residues at the N-terminus whereas a characteristic eight cysteine motif is located at the C-terminus. The PRPs support a number of developmental processes from germination to plant death. Under normal environmental conditions, PRP genes express customarily in different plant parts depending on the specific function to be carried out. During abiotic stresses, PRP genes exhibit an uneven pattern of transcriptional regulation depending on the time and intensity of stress. Transgenic plants overexpressing PRP genes show an enhanced tolerance to abiotic stresses. This review focuses on contemporary functions of PRPs during stresses and proposes that PRPs are involved in the regulation of free cellular proline content during stress in a well synchronized manner.

Heterologous expression of the AtDREB1A gene in tomato confers tolerance to chilling stress

S.G. Karkute, R. Krishna, W.A. Ansari, B. Singh, P.M. Singh, M. Singh, A.K. Singh

Biologia plantarum 63:268-277, 2019 | DOI: 10.32615/bp.2019.031

Tomato is highly sensitive to chilling stress (0 - 12 °C) which severely affects plant growth and development. Transgenic tomato plants expressing the AtDREB1A gene under the control of the rd29A promoter were evaluated for its tolerance to chilling stress by exposing them to 4 °C for 5 d. The cold stress caused an increase in production of reactive oxygen species, however, transgenic plants had an effective antioxidant system due to an enhanced synthesis of catalase (CAT), superoxide dismutase (SOD), and ascorbate and so the reduced content of hydrogen peroxide and superoxide anions. Transgenic plants showed a slightly less reduction of chlorophyll and carotenoid content compared to wild-type plants. Similarly, a higher relative water content and a less electrolyte leakage were observed in transgenic plants. Accumulation of osmoprotectants, like proline and soluble sugars, helped transgenic plants to maintain a proper osmotic balance under the cold stress. Stress-responsive genes pyrroline-5-carboxylate synthase, CAT, SOD, and lipid peroxidase showed enhanced expressions under the cold stress in transgenic plants compared to wild-type plants. A recurrent exposure to the cold stress at the reproductive stage showed even higher expressions of these genes as compared to plants exposed to the cold stress for the first time. Thus, transgenic plants showed a better adaptation to the cold stress than non-transgenic plants by acquiring the stress memory of the stress experienced at the seedling stage.

Recent advances and perspectives in crop biofortification

T. VLČKO, L. OHNOUTKOVÁ*

Biologia plantarum 63:586-593, 2019 | DOI: 10.32615/bp.2019.056

The increasing world population and limited amount of land area appropriate for intensive agriculture necessitate high-yield cultivars. The focus is on the enrichment of existing crops deficient in nutrients, which is also called biofortification. Microelements, vitamins, and fatty acids belong to most important traits being subjected to biofortification. Biofortification strategies can be divided on fertilization-based strategy, which is characterized by direct application of nutrients or plant growth promoting substances on plants, and biotechnological strategy, which involves molecular biology techniques in order to enhance transport, production, and accumulation of nutrients. Recent advances in plant biotechnology, such as genome-editing, clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9, and transcription activator-like effector nuclease, as well as an extensive study of genetic diversity, are acceptable approaches to the development of biofortified crops.

Changes in leaf tissue of Carica papaya during single and mixed infections with Papaya ringspot virus and Papaya mosaic virus

M. A. García-Viera, L. Sánchez-Segura, G. Chavez-Calvillo, D. Jarquín-Rosales, L. Silva-Rosales

Biologia plantarum 62:173-180, 2018 | DOI: 10.1007/s10535-017-0741-8

Papaya (Carica papaya L.) is susceptible to viral diseases caused by Papaya mosaic virus (PapMV) and Papaya ringspot virus (PRSV), which limit fruit production and affect economic yield. The symptoms produced by both the viruses are similar in early stages of infection and include vein and leaf chlorosis, which develop into mosaic at later stages of infection when leaf lamina can get reduced in size and distorted with a shoe-string aspect. Digital image analyses, such as fractal dimension (FD) and lacunarity (λ) were used here to examine papaya tissue after single and mixed infections of PRSV and PapMV. Morphological changes, such as hypoplasia, hyperplasia, and neoplasia are described in tissues with viral infections. Furthermore, we quantified these changes and suggest three ranges of tissue damage according to their λ values in rank 1 (0.01 to 0.39), rank 2 (0.4 to 0.79), and rank 3 (0.8 to 1). Our analyses suggest that in synergism and antagonism there is a competition of both viruses to occupy the same mesophyll cells, as indicated by their intermediate values of lacunarity.

MicroRNA319 family members play an important role in Solanum habrochaites and S. lycopersicum responses to chilling and heat stresses

X.P. Shi, F.L. Jiang, J.Q. Wen, S.Y. Cui, Y.Z. Zhou, Z. Wu

Biologia plantarum 63:200-209, 2019 | DOI: 10.32615/bp.2019.023

The microRNA319 (miR319) family is involved in plant development and responses to abiotic stresses. Previous work showed that miR319 responded to chilling stress in the chilling-tolerant wild tomato (Solanum habrochaites L.) genotype LA1777. Here, the precursors of sha-miR319a, b, c, and d were cloned from LA1777 and the putative target genes tosinte branched/cycloidea/proliferating cell factors (TCP3 and TCP29) were validated using 5′-RLM-RACE. Expression patterns revealed a negative correlation of sha-miR319 with TCP3 and TCP29 in LA1777. Four tomato (S. lycopersicum) genotypes with varying sensitivities to chilling and heat stresses were selected to characterize expression patterns of miR319 and target genes under extreme temperatures. The involvement of miR319 in the chilling tolerance of tomato might be mediated by the repression of TCP3 and TCP29 expression. Initial stages of heat stress resulted in the up-regulation of miR319a, b, and d and led to a decrease in TCP3, TCP29, and TCP2 expression, whereas the down-regulation of miR319c in the later stages of heat stress may have been responsible for the subsequent up-regulation of TCP3, TCP29, and TCP2. Cis-elements found in the promoter regions of the miR319 family members indicated a potential role of miR319 in the regulation of stress tolerance and development processes. This study provides insights into the role of miR319-mediated regulatory mechanisms in responses to temperature stress in tomato genotypes.

Growth, secondary metabolism, and related gene expression in response to interactions of nitrogen and sulfur in Isatis indigotica

Y.J. Miao, R.J. Qu, J.T. Sha, Y.W. Cao, J.L. Guan, J. Xu, X.Q. Tang, F.Q Wang, J. Yang

Biologia plantarum 63:411-417, 2019 | DOI: 10.32615/bp.2019.053

Nitrogen and sulfur are major elements influencing plant growth and production of secondary metabolites. They interact to each other, but little is known about it in Isatis indigotica Fort. plants. In this study, 15 different treatments representing all possible combinations of 3 N treatments (N1, N2, and N3, corresponding to 5, 15, and 25 mM N, respectively) and five S treatments (S0, S1, S2, S3, and S4, corresponding to 0.00, 1.25, 2.50, 5.00 and 7.50 mM S, respectively) were used, and plant growth, indigo and indirubin yields, and expressions of genes encoding enzymes involved in N and S metabolisms were measured. The results show that the highest dry biomass was observed in N2S2 treatment. Moreover, net photosynthetic rate in the N2S2 treatment was significantly higher than under other treatments (except for N3S2 treatment). A low nitrogen concentration (5 mM) was beneficial to the accumulation of alkaloids, and the N1S1 and N2S2 treatments resulted in the highest yields of indigo and indirubin, respectively. Additionally, the yields of indigo and indirubin were positively correlated with the expression of APS reductase and glutamine synthetase genes, respectively.

Overexpression of a gene AhFBA from Arachis hypogaea confers salinity stress tolerance in Escherichia coli and tobacco

Z.K. Du, Y.F. Hu, J.M. Li

Biologia plantarum 63:122-133, 2019 | DOI: 10.32615/bp.2019.015

Fructose-1,6-bisphosphate aldolase (FBA), an essential enzyme involved in the glycolytic pathway, gluconeogenesis, and the Calvin cycle, plays significant roles in the regulation of plant growth, development, and stress responses. In this study, a novel gene, AhFBA (GenBank accession number KF470788), containing a 1077-bp open reading frame and encoding a protein of 358 amino acids, was isolated from Arachis hypogaea L. Bioinformatic analysis revealed that AhFBA belonged to class-I aldolases and preferentially localized in the cytoplasm. Real-time quantitative PCR analysis indicated that AhFBA had a higher expression in young fruits than in leaves and stems, and NaCl could trigger the highest expression of AhFBA in roots and leaves after 3-h and 6-h treatments. The salinity tolerance and survival of Escherichia coli transformed with AhFBA were notably enhanced compared with the control. Transgenic tobacco (Nicotiana tabacum L.) overexpressing the AhFBA gene exhibited a lower hydrogen peroxide content, electrolyte leakage, and malondialdehyde content and a higher photosynthetic efficiency, net photosynthetic rate, relative water content, and sucrose and proline content compared with control plants. Taken together, the results demonstrate that AhFBA functioned as a positive factor enhancing the tolerance of E. coli and N. tabacum to salinity stress, possibly by maintaining the osmotic balance and scavenging hydrogen peroxide.

Overexpression of the UGT76E12 gene modulates seed germination, growth, and response to NaCl, mannitol, and abscisic acid

L. Chen, W.-S. Wang, Q. Liu, R.-R. Dong, Y.-J. Li, T.-T Chen, B.-K. Hou

Biologia plantarum 63:328-334, 2019 | DOI: 10.32615/bp.2019.038

Seed germination and following seedling growth are largely affected by environmental conditions. However, the genes involved in adaptations to these conditions are largely unknown. In this study, we cloned and characterized an Arabidopsis uridine diphosphate glycosyltransferase gene UGT76E12 and investigated its function in seed germination and plant growth under adverse environments. We found that UGT76E12 gene expression was induced by NaCl, mannitol, and abscisic acid (ABA) treatments. Under these treatments, the UGT76E12 overexpression lines exhibited a delayed seed germination and cotyledon growth compared with a wild type, and this delayed growth could be restored by treatment with sodium tungstate, an ABA synthesis inhibitor. Further, real-time quantitative PCR analysis reveals that the stress-induced expressions of genes involved in ABA biosynthesis were greatly enhanced in the UGT76E12 overexpression lines. Therefore, our data suggest that the UGT76E12 gene plays an important role in regulation of seed germination and growth under adverse environmental conditions by affecting ABA biosynthesis.

Proteome analysis of sesame leaves in response to waterlogging stress at vegetative and flowering stages

H.-J. JUNG, S.K. ROY, S.-W. CHO, S.-J. KWON, C. KUN, H.-C. CHUN, S.-H. WOO

Biologia plantarum 63:733-749, 2019 | DOI: 10.32615/bp.2019.062

Waterlogging, a major environmental stress, impairs plant growth and development and induces synthesis of different proteins. To understand the molecular mechanisms coupled with morpho-physiological alterations underlying waterlogging tolerance, the LTQ-FTICR MS/MS technique was employed to map the proteomes of leaves of sesame grown under control and waterlogged conditions. The waterlogging treatment caused dramatic alterations in morphological and biochemical properties of the leaves of sesame. For proteome analysis, more than 75 reproducible protein spots were identified on 2-DE gels wherein 51 protein spots (≥ 1.5-fold change) were used for analysis by mass spectrometry. Among 51 differentially abundant proteins, 20 were specific to the 10-leaf stage and 31 were specific to the flowering stage. Most of the differentially abundant proteins were involved in group metabolism, and energy and stress defense. Oxygen-evolving enhancer protein 1, ATP synthase subunit, heat shock proteins, glutamine synthetase, glyceraldehyde-3-phosphate dehydrogenase, and superoxide dismutase were upregulated under waterlogging. However, the photosynthesis- and protein biosynthesis-related proteins (e.g., ribulose-1,5-bisphosphate carboxylase/oxygenase activase, and S-adenosylmethionine synthase 1) were down-regulated under waterlogging. The protein interaction network indicates that energy metabolism- and stress- and defense-related proteins were involved in the protein-protein interaction network, which could form an indispensable network in sesame leaves. To this end, physiological results highlighted the impairment of photosyntheis, which is consistent with results obtained at the proteome level. The upregulation of metabolism-, energy-, and stress defense-related proteins in response to waterlogging stress may provide new insights into the complex mechanisms underlying waterlogging tolerance in sesame.

RNDr. Tomáš Gichner, DrSc.

Diana Stavreva

Biologia plantarum 63:iv-v, 2019


A leading figure in the field of plant genetics
RNDr. Tomáš Gichner, DrSc.
passed away on 6th January 2019 at the age of 83.

Shoot proliferation and organogenesis on Arbutus unedo: physiological analysis under water stress

J.F. Martins, S. Correia, B. Correia, G. Pinto, J.M. Canhoto

Biologia plantarum 63:278-286, 2019 | DOI: 10.32615/bp.2019.032

Strawberry tree (Arbutus unedo) is a small perennial tree that grows spontaneously in the Mediterranean basin, Ireland, and Portugal. In this work, strawberry tree clones were established in vitro from epicormic shoots obtained from a young tree, an adult tree, and from a seedling. They were propagated by axillary shoot buds proliferation on solid and in liquid media, and also in a modified De Fossard medium with 9 µM benzylaminopurine. The organogenesis from calli obtained from apical leaves of the in vitro grown shoots from the three genotypes was carried out in the same basal liquid medium supplemented with 9 µM thidiazuron. Micropropagation through organogenesis in liquid medium proved to be more efficient than the other tested methods (considering the number of shoots produced), but the shoots were showing hyperhydricity. Shoots were sucessufully rooted on medium with indole-3-butyric acid and acclimatized ex vitro with rates higher than 90 %. Six month-old plants from the most proliferative genotype (AU1) and propagated in vitro by different methods were submitted to drought stress (no watering for 10 d) and several morphological and physiological parameters were evaluated and compared to a control group (watered to 70 % field capacity). No significant differences were found in plant biomass, root length, and plant height, however, slight differences were observed in water potential, net photosynthetic rate, intercellular CO2 concentration, and stomatal conductance between the plantlets propagated on solid or liquid medium. In general, the responses to drought stress imposed were was similar in plants micropropagated by different propagation methods.

A novel potato microRNA stu-miR856 regulates mitogen-activatedprotein kinase genes contributing to drought tolerance

J.W. YANG, X. ZHU, S.G. LI, X. TANG, N. ZHANG, H.J. SI

Biologia plantarum 63:618-626, 2019 | DOI: 10.32615/bp.2019.067

Mitogen-activated protein kinases (MAPKs) are significant components of MAPK cascades, which play versatile roles in different transduction pathways to mediate stress adaptation. However, little information is known about post-transcriptional regulation of MAPK genes in plant under drought stress. MicroRNAs (miRNAs), a class of newly identified, short non-coding RNAs, regulate the expression of target genes in plant growth, development, and stress responses. In order to investigate the mechanism of miRNA regulating MAPK genes in potato, we identified a novel potato miRNA with the sequence CGGCCTTAATAAGATGGTGAAG and named it as stu-miR856 depending on miRNA deep sequencing and bioinformatic analysis. Target prediction indicates that it can bind to the coding sequence region of two potato MAPK-like genes, and cleavage positions of them were also effectively validated by RNA ligase-mediated 5' rapid amplification of cDNA ends assay. In addition, expressional analysis shows that stu-miR856 and its targets exhibited an opposite expression pattern: stu-miR856 expression significantly decreased while its target genes greatly increased in the different stages of drought treatment. The results indicate that a decreased expression of stu-miR856 might drive overexpression of two StMAPK genes family members, which may contribute to regulation of the drought adaptation of potato plants.

Comparative analysis of DNA methylation changes in two contrasting wheat genotypes under water deficit

A. Kaur, A. Grewal, P. Sharma

Biologia plantarum 62:471-478, 2018 | DOI: 10.1007/s10535-018-0786-3

DNA methylation is one of the epigenetic mechanisms regulating gene expression in plants in response to environmental conditions. In this study, analysis of methylation patterns was carried out in order to assess the effect of water stress in two contrasting wheat genotypes using methylation-sensitive amplified polymorphism (MSAP). The results revealed that demethylation was higher in drought-tolerant genotype (C306) as compared to drought-sensitive genotype (HUW468) after experiencing drought stress. Comparisons of different MSAP patterns showed a high percentage of polymorphic bands between tolerant and susceptible wheat genotypes (from 74.79 % at anthesis to 88.89 % at tillering). Furthermore, differential DNA methylation in roots and leaves also revealed tissue-specific methylation of genomic DNA. Interestingly, 54 developmental stage-specific bands and 23 bands that were found contrasting between these two wheat genotypes were detected. Furthermore, a few sites with stable DNA methylation differences were identified between drought-tolerant and drought-sensitive cultivars, thus providing genotype-specific epigenetic markers. These results not only provide data on differences in DNA methylation changes but also contribute to dissection of molecular mechanisms of drought response and tolerance in wheat.

The gene OsIAA9 encoding auxin/indole-3-acetic acid proteins is a negative regulator of auxin-regulated root growth in rice

Y.L. Song

Biologia plantarum 63:210-218, 2019 | DOI: 10.32615/bp.2019.024

Auxin signal transduction in plants depends on regulation by short-lived nuclear plant proteins called auxin/indole-3-acetic acid (Aux/IAA) proteins. The OsIAA9, which is highly and rapidly induced by auxin, encodes the entire Aux/IAA domain characteristic of the Aux/IAA family in rice. The promoter region of OsIAA9 contains several cis-elements. Analysis of POsIAA9:GUS transgenic plants indicates a specific expression of OsIAA9 in roots and seedling shoots, especially lateral roots and root tips. Based on real-time PCR, the expression of OsIAA9 was induced by multiple hormones and abiotic stresses. Furthermore, ectopic overexpression of OsIAA9 in rice led to fewer crown and lateral roots and reduced the inhibition of root elongation by auxin. These observations indicate that OsIAA9 was a negative regulator of auxin-regulated root growth.

Effects of various winter chilling regimes on flowering quality indicators of Greek olive cultivars

G. KOUBOURIS, I. LIMPERAKI, M. DARIOTI, C. SERGENTANI

Biologia plantarum 63:504-510, 2019 | DOI: 10.32615/bp.2019.065

Aims of the present two-year study were to evaluate the feasibility and identify potential drawbacks of the greenhouse/outdoors parallel plant growth methods for investigation of the effects of various winter chilling regimes on flowering quality indicators of four Greek olive cultivars, namely Mastoidis, Amfissis, and Lefkolia Serron (originating from mountainous and colder areas) compared to cv. Koroneiki (grown mainly in plain warm areas). Groups of potted olive plants were either grown outdoors under ambient temperature or transferred into a greenhouse for one, two, or three months during winter in Crete, Greece. During the first year, chilling accumulation deficit caused a marked decrease in the number of inflorescences per plant in all four olive cultivars. In the second year, chilling accumulation deficit had a negative effect on the number of inflorescences per plant in 'Mastoidis' at 3-month greenhouse treatment but not at all in 'Koroneiki'. Chilling deficit caused an overall decrease in the number of flowers per inflorescence in both 'Koroneiki' and 'Mastoidis' as well as in the percentage of morphologically perfect flowers. The width and length of inflorescences were not affected by chilling deficit in both the cultivars. In vitro pollen germination was reduced in all greenhouse treatments in 'Koroneiki'; however, this effect was significant only after 3 month, whereas no effect was observed in 'Mastoidis'. The results of the present study may contribute to understanding olive flowering biology and selecting appropriate cultivars for new plantations according to historical meteorological data and predicted climate change scenarios.

Deficiency in phytochromobilin biosynthesis enhances heat-stress-induced impairments to the photosynthetic apparatus in tomato

A.J. Crispim Filho, A.C. Costa, F.R.R. Alves, P.F. Batista, A.A. Rodrigues, S.C. Vasconcelos Filho, K.J.T. Nascimento

Biologia plantarum 63:134-144, 2019 | DOI: 10.32615/bp.2019.016

Plants are continuously exposed to unfavorable environmental conditions, such as heat stress, which negatively affect plant growth and productivity. There is evidence that phytochromes are involved in plant response to different abiotic stresses. We investigated the possible phytochrome-dependent responses to heat stress in photomorphogenic tomato mutants aurea (au, phytochromobilin-deficient, PΦB) and high-pigment 1 (hp1, hyperresponsive to phytochrome-mediated responses), as well as the wild-type Micro-Tom (MT). In comparison with MT, reductions in photosynthetic rate promoted by a high temperature were more pronounced in au, whereas less pronounced in hp1. All genotypes subjected to the heat stress exhibited adjustments in the capture and dissipation of energy, which were indicated by increases in the initial fluorescence and decreases in the maximum photochemical efficiency of photosystem II (PS II). The effective quantum yield of PS II and the apparent electron transport rate showed greatest alterations in the au mutant. In addition, heat-triggered anatomical changes occurred in all genotypes but were most conspicuous in the au mutant, followed by MT. Thus, phytochrome-dependent mechanisms played pivotal roles in the plant responses to the heat stress, and deficiency in phytochromobilin biosynthesis enhanced the heat-induced impairment of photosynthetic performance.

Differential expressions of citrus CAMTAs during fruit development and responses to abiotic stresses

Z.G. Ouyang, L.F. Mi, H.H. Duan, W. Hu, J.M. Chen, T. Peng, B.L. Zhong

Biologia plantarum 63:354-364, 2019 | DOI: 10.32615/bp.2019.041


Calmodulin-binding transcription activators (CAMTAs) play important roles in plant growth, developmental processes, and responses to abiotic and biotic factors. Recently, five CAMTA members were identified in Citrus sinensis, however, very little is known about the molecular regulation of these CAMTAs in citrus during fruit development and under abiotic stresses. In this study, the different expression profiles of CsCAMTA genes were found in different tissues and different fruit developmental stages. The CsCAMTA genes also displayed distinct expression patterns after heat, cold, salt, and drought stresses. Furthermore, the expressions of CsCAMTA genes were significantly induced by treatments with salicylic acid, methyl jasmonate, or abscisic acid. The green fluorescent protein gene fused with CsCAMTA was specifically expressed in the nucleus of Nicotiana benthamiana cells. Additionally, CsCAMTA proteins can activate or suppress DNA transcription in yeast. These findings provide helpful information for further studies of stress signals in citrus.

Constitutive expression of the wheat TaSOD5 gene enhances salinity tolerance of Arabidopsis thaliana

Y.-G. SONG, T.-X. GAO, X.-J. LIU, W. DONG*

Biologia plantarum 63:750-756, 2019 | DOI: 10.32615/bp.2019.108

Superoxide dismutase is a crucial reactive oxygen species (ROS) scavenger and converts the superoxide radical (O2-) to H2O2, so it is thought to enhance abiotic stress tolerance by reducing ROS accumulation and so avoiding oxidative damage. In this study, we isolated a salt- and oxidative stress-responsive Cu/Zn SOD gene TaSOD5 from wheat. The ectopic overexpression of TaSOD5 in Arabidopsis increased total and Cu/Zn SOD activities, and offered the plant tolerance to salt stress. Arabidopsis ectopically expressing TaSOD5 possessed a superior resistance to oxidative stress induced H2O2. The TaSOD5 ectopic overexpression elevated the activities of both ROS scavengers and O2- producer NADPH oxidase. These findings show that Cu/Zn SOD enhances salt tolerance via regulating the machinery of redox homeostasis rather than improving SOD activity alone.

The homoeologous genes encoding C24-sterol methyltransferase 1 in Triticum aestivum: structural characteristics and effects of cold stress

A. Renkova, J. Valitova, H. Schaller, F. Minibayeva

Biologia plantarum 63:59-69, 2019 | DOI: 10.32615/bp.2019.008

A unique structural feature of plant sterols is the presence of a 24-alkyl group in the sterol side chain, which is synthesized by C24-sterol methyltransferase (SMT). Here we report for the first time that the bread wheat genome (AABBDD) contains at least three homoeologous genes encoding C24-sterol methyltransferase 1. While these copies have similar coding regions, they differ markedly in the nucleotide sequences of their non-coding regions. Sequencing de novo of the promoter regions of the TaSMT1 homoeologs demonstrated the occurrence of common and specific stress-sensitive cis-elements such as LTR, the cis-element involved in low temperature response. These cis-elements, along with other factors, determine the differences in the effects of stress on the expression of homoeologous TaSMT1 genes. For example, TaSMT1-5A is constitutively expressed in the roots and leaves, while TaSMT1-4D gene is highly stress-responsive. Another important enzyme involved in sterol biosynthesis is C22-sterol desaturase, which converts β-sitosterol into stigmasterol. This enzyme is encoded by homoeologous TaCYP710A8 genes, which, in contrast to TaSMT1, are all up-regulated in response to stress. Cold-induced expression of TaCYP710A8 is greater in roots than in leaves. This may be due to the higher cold sensitivity of the roots and the necessity to increase the amount of stigmasterol known as a “stress sterol”. Our findings suggest that the existence of homoeologous genes of sterol biosynthesis in polyploid plants supports the diversity of genetic mechanisms of sterol-mediated response of plants to stresses.

Effect of aluminum and fluoride on R2R3-MYB transcription factor characterization and expression in Camellia sinensis

Y. Wang, P. Chang, J. Pan, J. Zhu, C. Cui, X. Ye, Y. Ma, X. Zhu, W. Fang, C. Jiang

Biologia plantarum 63:298-307, 2019 | DOI: 10.32615/bp.2019.034


Tea plant (Camellia sinensis) is a typical plant that accumulates abundant aluminum (Al) and fluoride (F). Al and F play vital roles in the growth and development in tea plant. MYB (myeloblastosis) is one of the largest transcription factor families in plant, which plays an important role in the stress responses. As the largest and multifunctional subfamily of MYB, R2R3-MYB subfamily participates in multiple abiotic stresses in plant. However, there are few studies about R2R3-MYB in tea plant, especially in the accumulation of Al and F during its growth. Here, we identified 43 CsMYB genes from the transcriptome database of tea plant and analyzed the relative expression in Al and F treatments. According to the Arabidopsis thaliana classification, 43 CsMYB genes are divided into 18 subgroups via phylogenetic tree analysis. All 43 CsMYB proteins have the typical R2R3-MYB domain by MEME prediction. Moreover, 9 CsMYB genes (CsMYB11, CsMYB17, CsMYB29, CsMYB38 to CsMYB43) that related to abiotic stress were selected from 43 CsMYB genes for a further study, and the relative expressions showed that they are tissue-specifically expressed. In addition, the results of different concentrations of Al treatments showed that CsMYB11, -17, -29, -38 and -41 are stimulated by Al treatment. The results of different concentrations of F treatments showed that the CsMYB11, -17, -38, -39, -40, -41, -42 and -43 participate in F accumulation of C. sinensis roots. Our research establishes a solid foundation for further investigation into the molecular functions of R2R3-MYB transcription factors in C. sinensis.

Overexpression of the alfalfa zeaxanthin epoxidase gene delaysseed germination in transgenic tobacco

Y.M. CAO, Z.Q. ZHANG, T. ZHANG, J. AN, L.Q. CHANG, Y.F. WANG, H.X. WU, T.M. HU, P.Z. YANG

Biologia plantarum 63:627-632, 2019 | DOI: 10.32615/bp.2019.059

Zeaxanthin epoxidase (ZEP) plays important roles in plant growth and development due to its functions in abscisic acid (ABA) biosynthesis and in the xanthophyll cycle. Many studies have been exploring the roles of ZEP in seed germination and response to various environmental stresses. In this study, we reported that heterologously overexpressing the ZEP gene from Medicago sativa (MsZEP) in tobacco increased ABA content in tobacco mature seeds and negatively regulated seed germination. Enhanced ABA synthesis in seed embryo and delayed germination might also be related to the increased 9-cis-epoxycarotenoid dioxygenase (NCED6) expression. Moreover, we found that overexpression of MsZEP resulted in an increased expression of the SOMNUS gene but a decreased expression of the DNA ligase 6 gene (Lig6) suggesting that MsZEP might affect seed proteome and DNA integrity. Furthermore, enhanced chlorophyll content in transgenic tobacco seedlings overexpressing MsZEP might be due to its function in the xanthophyll cycle and ABA biosynthesis.

RNDr. Bohdan Slavík, DrSc.

J. Krekule

Biologia plantarum 63:iii, 2019


A leading figure in the field of plant physiology
RNDr. Bohdan Slavík, DrSc.
passed away on 1st August 2018 at the age of 93.

Effects hydrogen sulfide on the antioxidant system and membrane stability in mitochondria of Malus hupehensis under NaCl stress

G.-Q. Wei, W.-W. Zhang, H. Cao, S.-S. Yue, P. Li, H.-Q. Yang

Biologia plantarum 63:228-236, 2019 | DOI: 10.32615/bp.2019.026

Salt stress is one of the most critical environmental factors limiting plant growth, and hydrogen sulfide (H2S) can play a role in plant responses to this stress. To investigate the effects of H2S on mitochondrial functions under salt stress, we treated Malus hupehensis Rehd. var. pingyiensis germinating seeds with an 85 mM NaCl solution with or without an H2S donor sodium hydrosulfide (NaHS) and H2S scavenger hypotaurine (HT). Then, hydrogen peroxide (H2O2) content and antioxidant enzyme activities were measured in mitochondria of seedling roots. Our results show that the application of 0.05 mM NaHS rescued an NaCl-induced inhibition of root elongation, decreased H2O2 content, and enhanced superoxide dismutase (SOD), guaiacol peroxidase (POD), and catalase (CAT) activities in the mitochondria compared to NaCl treatment alone. It was also found that 0.05 mM NaHS significantly decreased the mitochondrial permeability transition pore and increased mitochondrial membrane fluidity, mitochondrial membrane potential, and cytochrome c/a ratio under NaCl stress. However, 0.02 mM NaHS did not affect root growth, antioxidant enzyme activities, and mitochondrial function under NaCl stress, whereas high concentrations of NaHS (more than 0.2 mM) had a weaker or negative effects. Moreover, 15 µM HT eliminated the beneficial effects of NaHS under NaCl stress. Our results suggest that H2S protected plants against salt stress by decreasing H2O2 accumulation and by regulating membrane stability and antioxidant system in mitochondria.

 previous    1   2   3   4   5   6  7   8   9   10   11   ...    next